Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF764361.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF764361.1, 422 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12112261|gb|BF764361.1|BF764361 CM3-CS0005-311000-454-h07 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

13-422  (187329-187739)   99%

      0     .    :    .    :    .    :    .    :    .    :
     13 GATAAATGGCTTCCTGGC ATAGTCAAATTGTGTGAAAGGTACTTCAAAT
        ||||||||||||||||||-|||||||||||||||||||||||||||||||
 187329 GATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAAT

     50     .    :    .    :    .    :    .    :    .    :
     62 CCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAAAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187379 CCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAAAACC

    100     .    :    .    :    .    :    .    :    .    :
    112 CTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187429 CTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCT

    150     .    :    .    :    .    :    .    :    .    :
    162 AGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||| ||
 187479 AGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAG

    200     .    :    .    :    .    :    .    :    .    :
    212 AAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAACTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187529 AAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAACTGG

    250     .    :    .    :    .    :    .    :    .    :
    262 AAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187579 AAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCC

    300     .    :    .    :    .    :    .    :    .    :
    312 ATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187629 ATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCT

    350     .    :    .    :    .    :    .    :    .    :
    362 CATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187679 CATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATC

    400     .    :
    412 AAAATACGCCC
        |||||| ||||
 187729 AAAATATGCCC

END