Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF764364.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF764364.1, 299 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12112264|gb|BF764364.1|BF764364 CM3-CS0005-311000-443-a09 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

10-260  (1508-1754)   96% <-
261-299  (3098-3136)   100%

      0     .    :    .    :    .    :    .    :    .    :
     10 TCATAACATTCCATGAGCAAATGT CCATGTCAACATTTATGCTGCTCTC
        || -|--|||||||||||||||||-|||||||||||||||||||||||||
   1508 TCC A  ATTCCATGAGCAAATGTCCCATGTCAACATTTATGCTGCTCTC

     50     .    :    .    :    .    :    .    :    .    :
     59 TAAAGCCTTGTATCTTGCACCTCTTCTTCTGTCTCCTCTTTCAGAGCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1555 TAAAGCCTTGTATCTTGCACCTCTTCTTCTGTCTCCTCTTTCAGAGCAGC

    100     .    :    .    :    .    :    .    :    .    :
    109 AATCTGGGGCTTAGACTTGCACTTGCTTGAGTTCCGGTGGGGAAAGAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1605 AATCTGGGGCTTAGACTTGCACTTGCTTGAGTTCCGGTGGGGAAAGAGCT

    150     .    :    .    :    .    :    .    :    .    :
    159 TCACCNCTGTCGGAGGGGCTGATGGCTTGCNCGGAAGAGGCTCCTCTCGT
        |||||-||||||||||||||||||||||||-|||||||||||||||||||
   1655 TCACC CTGTCGGAGGGGCTGATGGCTTGC CGGAAGAGGCTCCTCTCGT

    200     .    :    .    :    .    :    .    :    .    :
    209 TCAGCAGTTTCTGGATGGAATCGTACTGCCGCACTCTGTTCTCTTCTATG
        ||||||||||||||||||||||||||||||||||| ||||||||||||||
   1703 TCAGCAGTTTCTGGATGGAATCGTACTGCCGCACTTTGTTCTCTTCTATG

    250     .    :    .    :    .    :    .    :    .    :
    259 AC         CAAAAATTGTTGGCATTCCAGCATTGCTTCTATCCTGTG
        ||<<<...<<<|||||||||||||||||||||||||||||||||||||||
   1753 ACCTA...CACCAAAAATTGTTGGCATTCCAGCATTGCTTCTATCCTGTG

END