Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF764368.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF764368.1, 396 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12112268|gb|BF764368.1|BF764368 CM3-CS0005-311000-454-b05 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-396  (571-968)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 ACC CTATCA CCTATACATCTAAATGCTTGGACTTCATGTGTGTCTACC
        |||-| ||||-|||||||||||||||||||||||||||||||||||||||
    571 ACCACCATCAACCTATACATCTAAATGCTTGGACTTCATGTGTGTCTACC

     50     .    :    .    :    .    :    .    :    .    :
     49 CACAGTGCCCATGGCCTATCTACTTACACACCCTCTACCTGGAGCTTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    621 CACAGTGCCCATGGCCTATCTACTTACACACCCTCTACCTGGAGCTTCTG

    100     .    :    .    :    .    :    .    :    .    :
     99 TGGAAAGAAGGGCTGTCCTGTGACAATTTGCACTAACATACTTTTCCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    671 TGGAAAGAAGGGCTGTCCTGTGACAATTTGCACTAACATACTTTTCCAGC

    150     .    :    .    :    .    :    .    :    .    :
    149 TAAACTCTAGTTCAAAGGTCTGTGAGCTTGTCACTTTCTGGAGTTGGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    721 TAAACTCTAGTTCAAAGGTCTGTGAGCTTGTCACTTTCTGGAGTTGGGAA

    200     .    :    .    :    .    :    .    :    .    :
    199 AAGGCATATCAACTTCTTCATCAAGGGAACCATCCTGTCCCCTGTGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    771 AAGGCATATCAACTTCTTCATCAAGGGAACCATCCTGTCCCCTGTGAAAG

    250     .    :    .    :    .    :    .    :    .    :
    249 ATTATAACAGCCCTTTCCCAGGTAAGGGATGTATTGTGATTATCTGAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    821 ATTATAACAGCCCTTTCCCAGGTAAGGGATGTATTGTGATTATCTGAAAT

    300     .    :    .    :    .    :    .    :    .    :
    299 ATTGAGATTTTTGGTAGACCTGGACAATACTAACCCTGATTTCCAGGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    871 ATTGAGATTTTTGGTAGACCTGGACAATACTAACCCTGATTTCCAGGATC

    350     .    :    .    :    .    :    .    :    .
    349 TGGAAGTTCTCTTTCCTGACTGCTCACTAGATGTTGAATGGGGCATAT
        ||||||||||||||||||||||||||||||||||||||||||||||||
    921 TGGAAGTTCTCTTTCCTGACTGCTCACTAGATGTTGAATGGGGCATAT

END