Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF764375.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF764375.1, 419 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12112275|gb|BF764375.1|BF764375 CM3-CS0005-311000-454-d07 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-419  (269-689)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GAACCCTATCCCAGTTTTAACATAATATTTCATAGAAATACTAGTGCCAT
           |||| ||||||||||||||||||||||||||||||||||||||||||
    269 CTCCCCTGTCCCAGTTTTAACATAATATTTCATAGAAATACTAGTGCCAT

     50     .    :    .    :    .    :    .    :    .    :
     51 AAAAAGTCAATATTTCAAATAT AAAATTATTTTATACAAATGT ATTCA
        ||||||||||||||||||||||-|||||||||||||||||||||-|||||
    319 AAAAAGTCAATATTTCAAATATAAAAATTATTTTATACAAATGTAATTCA

    100     .    :    .    :    .    :    .    :    .    :
     99 TAATCATTCTTTTAAGATACAGCATTGTTATATATGTTTGAAACATTATT
        ||||||||||||||| ||||||||||||||||||||||||||||||||||
    369 TAATCATTCTTTTAAAATACAGCATTGTTATATATGTTTGAAACATTATT

    150     .    :    .    :    .    :    .    :    .    :
    149 AAAATAAATATTTCCTAGAGAAAAAATTTTGCTTCACAAAATTATAAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    419 AAAATAAATATTTCCTAGAGAAAAAATTTTGCTTCACAAAATTATAAAAC

    200     .    :    .    :    .    :    .    :    .    :
    199 AGAAGCATATAAAACTAATTCATGATTGGTGCTTCTTCAGTGTGTCTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    469 AGAAGCATATAAAACTAATTCATGATTGGTGCTTCTTCAGTGTGTCTCTC

    250     .    :    .    :    .    :    .    :    .    :
    249 ATTCTCTCTTAGTGTAGACAGCATGAAGTACATACATCTAGCCTGAAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    519 ATTCTCTCTTAGTGTAGACAGCATGAAGTACATACATCTAGCCTGAAAAC

    300     .    :    .    :    .    :    .    :    .    :
    299 ATACCACCATCAACCTATACATCTAAATGCTTGGACTTCATGTGTGTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    569 ATACCACCATCAACCTATACATCTAAATGCTTGGACTTCATGTGTGTCTA

    350     .    :    .    :    .    :    .    :    .    :
    349 CCCACAGTGCCCATGGCCTATCTACTTACACACCCTCTACCTGGAGCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    619 CCCACAGTGCCCATGGCCTATCTACTTACACACCCTCTACCTGGAGCTTC

    400     .    :    .    :
    399 TGTGGAAAGAAGGGCTGTCCT
        |||||||||||||||||||||
    669 TGTGGAAAGAAGGGCTGTCCT

END