Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF764393.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF764393.1, 447 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12112293|gb|BF764393.1|BF764393 CM3-CS0005-311000-443-d09 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

11-447  (273-711)   99%

      0     .    :    .    :    .    :    .    :    .    :
     11 CCTAT CCAGTTTTAACATAATATTTCATAGAAATACTAGTGCCATAAAA
        ||| |-||||||||||||||||||||||||||||||||||||||||||||
    273 CCTGTCCCAGTTTTAACATAATATTTCATAGAAATACTAGTGCCATAAAA

     50     .    :    .    :    .    :    .    :    .    :
     60 AGTCAATATTTCAAATATAAAAATTATTTTATACAAATGT ATTCATAAT
        ||||||||||||||||||||||||||||||||||||||||-|||||||||
    323 AGTCAATATTTCAAATATAAAAATTATTTTATACAAATGTAATTCATAAT

    100     .    :    .    :    .    :    .    :    .    :
    109 CATTCTTTTAAGATACAGCATTGTTATATATGTTTGAAACATTATTAAAA
        ||||||||||| ||||||||||||||||||||||||||||||||||||||
    373 CATTCTTTTAAAATACAGCATTGTTATATATGTTTGAAACATTATTAAAA

    150     .    :    .    :    .    :    .    :    .    :
    159 TAAATATTTCCTAGAGAAAAAATTTTGCTTCACAAAATTATAAAACAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    423 TAAATATTTCCTAGAGAAAAAATTTTGCTTCACAAAATTATAAAACAGAA

    200     .    :    .    :    .    :    .    :    .    :
    209 GCATATAAAACTAATTCATGATTGGTGCTTCTTCAGTGTGTCTCTCATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    473 GCATATAAAACTAATTCATGATTGGTGCTTCTTCAGTGTGTCTCTCATTC

    250     .    :    .    :    .    :    .    :    .    :
    259 TCTCTTAGTGTAGACAGCATGAAGTACATACATCTAGCCTGAAAACATAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    523 TCTCTTAGTGTAGACAGCATGAAGTACATACATCTAGCCTGAAAACATAC

    300     .    :    .    :    .    :    .    :    .    :
    309 CACCATCAACCTATACATCTAAATGCTTGGACTTCATGTGTGTCTACCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    573 CACCATCAACCTATACATCTAAATGCTTGGACTTCATGTGTGTCTACCCA

    350     .    :    .    :    .    :    .    :    .    :
    359 CAGTGCCCATGGCCTATCTACTTACACACCCTCTACCTGGAGCTTCTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    623 CAGTGCCCATGGCCTATCTACTTACACACCCTCTACCTGGAGCTTCTGTG

    400     .    :    .    :    .    :    .
    409 GAAAGAAGGGCTGTCCTGTGACAATTTGCACTAACATAC
        |||||||||||||||||||||||||||||||||||||||
    673 GAAAGAAGGGCTGTCCTGTGACAATTTGCACTAACATAC

END