Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF772697.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF772697.1, 381 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|12120597|gb|BF772697.1|BF772697 IL5-IT0027-131200-328-f10 IT0027 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

1-144  (259207-259350)   100% ->
145-271  (261766-261892)   100% ->
272-381  (263495-263604)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259207 CCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTT

     50     .    :    .    :    .    :    .    :    .    :
     51 TCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259257 TCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAG

    100     .    :    .    :    .    :    .    :    .    :
    101 CAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCT      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
 259307 CAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTG...

    150     .    :    .    :    .    :    .    :    .    :
    145    GTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAAT
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
 261763 CAGGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAAT

    200     .    :    .    :    .    :    .    :    .    :
    192 CGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261813 CGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATCT

    250     .    :    .    :    .    :    .    :    .    :
    242 CATCAGCTTCACCGTTTACTACAAGGAAGC         ACCCTTTAAGA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
 261863 CATCAGCTTCACCGTTTACTACAAGGAAGCGTG...CAGACCCTTTAAGA

    300     .    :    .    :    .    :    .    :    .    :
    283 ATGTCACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263506 ATGTCACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAAC

    350     .    :    .    :    .    :    .    :    .
    333 ATGGTGGACGTGGACCTCCCGCCCAACAAGGACGTGGAGCCCGGCATCT
        |||||||||||||||||||||||||||||||||||||||||||||||||
 263556 ATGGTGGACGTGGACCTCCCGCCCAACAAGGACGTGGAGCCCGGCATCT

END