Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF801061.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF801061.1, 233 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12130050|gb|BF801061.1|BF801061 CM4-CI0063-231000-375-h02 CI0063 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-233  (689-920)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGCTGACAATGTGCACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAG
        ||-||||||| |||||||||||||||||||||||||||||||||||||||
    689 TG TGACAATTTGCACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAG

     50     .    :    .    :    .    :    .    :    .    :
     51 GTCTGTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    738 GTCTGTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCT

    100     .    :    .    :    .    :    .    :    .    :
    101 TCATCAAGGGAATCATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTTC
        |||||||||||| |||||||||||||||||||||||||||||||||||||
    788 TCATCAAGGGAACCATCCTGTCCCCTGTGAAAGATTATAACAGCCCTTTC

    150     .    :    .    :    .    :    .    :    .    :
    151 CCAGGTAAGGGATGTATTGTGATTATCTGAAATATTGAGATTTTTGGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    838 CCAGGTAAGGGATGTATTGTGATTATCTGAAATATTGAGATTTTTGGTAG

    200     .    :    .    :    .    :
    201 ACCTGGACAATACTAACCCTTATTTCCAGGATC
        |||||||||||||||||||| ||||||||||||
    888 ACCTGGACAATACTAACCCTGATTTCCAGGATC

END