Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF801066.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF801066.1, 281 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12130055|gb|BF801066.1|BF801066 CM4-CI0063-231000-375-h11 CI0063 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-281  (187671-187951)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 AAATATCTCATTTCCAATGCA GTATTAGAATACCACAGGAACCACAAGA
        || ||||||||||||||-|||-||||||||||||||||||||||||||||
 187671 AACTATCTCATTTCCAA GCAAGTATTAGAATACCACAGGAACCACAAGA

     50     .    :    .    :    .    :    .    :    .    :
     50 CTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187720 CTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAG

    100     .    :    .    :    .    :    .    :    .    :
    100 AGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187770 AGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAA

    150     .    :    .    :    .    :    .    :    .    :
    150 AAATCTCAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187820 AAATCTCAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGG

    200     .    :    .    :    .    :    .    :    .    :
    200 CTGTTATAATCTTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187870 CTGTTATAATCTTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTT

    250     .    :    .    :    .    :
    250 GATATGCCTTTTCCCAACTCCAGAAAGTGACA
        ||||||||||||||||||||||||||||||||
 187920 GATATGCCTTTTCCCAACTCCAGAAAGTGACA

END