Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF808392.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF808392.1, 377 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|12137368|gb|BF808392.1|BF808392 RC3-CI0043-121100-024-c02 CI0043 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

15-377  (76119-76481)   96%

      0     .    :    .    :    .    :    .    :    .    :
     15 TCCTCTGGATGCTGTAGTCTTTCGGGTGAATGTTCTGACCTTGGTT ACT
        || | |||||||||| |||||||||-||||||||||||||||||||-|||
  76119 TCGTGTGGATGCTGTTGTCTTTCGG TGAATGTTCTGACCTTGGTTAACT

     50     .    :    .    :    .    :    .    :    .    :
     64 GAGTGTGTCATCAGGTTCAGGACAGACTGCCTCCTTCGTGCCTGAAGCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76168 GAGTGTGTCATCAGGTTCAGGACAGACTGCCTCCTTCGTGCCTGAAGCGT

    100     .    :    .    :    .    :    .    :    .    :
    114 GGGGCCAGTGCTGATCACGCTGATGCGAGGCAGTATCGCCTCTCCCTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76218 GGGGCCAGTGCTGATCACGCTGATGCGAGGCAGTATCGCCTCTCCCTGCT

    150     .    :    .    :    .    :    .    :    .    :
    164 CAGAATCTGGTACTAAGGACAGCCTTCTCTCTAAAGGCTCATCAGAATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76268 CAGAATCTGGTACTAAGGACAGCCTTCTCTCTAAAGGCTCATCAGAATCC

    200     .    :    .    :    .    :    .    :    .    :
    214 TCTTCGATGCCATTCATTTGTAAGGGAGTCTTTGGCACAATGGACAATTT
        ||||||||||||||||||||||||||||||||| |||||||||| |||||
  76318 TCTTCGATGCCATTCATTTGTAAGGGAGTCTTTTGCACAATGGAAAATTT

    250     .    :    .    :    .    :    .    :    .    :
    264 TCGTATAGAGTTGATTGGATTGAGAATAGAATTCTTCCTTTTTTCCCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76368 TCGTATAGAGTTGATTGGATTGAGAATAGAATTCTTCCTTTTTTCCCCAA

    300     .    :    .    :    .    :    .    :    .    :
    314 ACTCTCCAGTCTGTCTAACAGATTGTATTCTTGTTTCTGTCCAGGAGACA
        |||||||||||||| ||| ||||||| || ||||||||||||||||||||
  76418 ACTCTCCAGTCTGTTTAAAAGATTGTTTTTTTGTTTCTGTCCAGGAGACA

    350     .    :
    364 GGAGCATCTCCTTC
        ||||||||||||||
  76468 GGAGCATCTCCTTC

END