Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF832647.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF832647.1, 562 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|12181547|gb|BF832647.1|BF832647 PM0-HT0911-191000-004-c01 HT0911 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

1-92  (259258-259350)   96% ->
93-219  (261766-261892)   98% ->
220-458  (263495-263733)   100% ->
459-562  (266415-266518)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGG GCGCAAAG
        |||||||||||||||||||||||||||||||||||||||||-||-|||||
 259258 CCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGC CAAAG

     50     .    :    .    :    .    :    .    :    .    :
     50 CAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGC TCCT      
        |||||||||||||||||||||||||||||||||||||||-||||>>>...
 259307 CAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTG...

    100     .    :    .    :    .    :    .    :    .    :
     93    GTGAAAGTGACGTCCTGCATTTCACCTCCCACCAC ACGTCGAAGAA
        >>>|||||||||||||||||||||||||||-|||||||-|||||||||||
 261763 CAGGTGAAAGTGACGTCCTGCATTTCACCT CCACCACCACGTCGAAGAA

    150     .    :    .    :    .    :    .    :    .    :
    139 TCGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261812 TCGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATC

    200     .    :    .    :    .    :    .    :    .    :
    189 TCATCAGCTTCACCGTTTACTACAAGGAAGC         ACCCTTTAAG
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
 261862 TCATCAGCTTCACCGTTTACTACAAGGAAGCGTG...CAGACCCTTTAAG

    250     .    :    .    :    .    :    .    :    .    :
    230 AATGTCACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263505 AATGTCACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAA

    300     .    :    .    :    .    :    .    :    .    :
    280 CATGGTGGACGTGGACCTCCCGCCCAACAAGGACGTGGAGCCCGGCATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263555 CATGGTGGACGTGGACCTCCCGCCCAACAAGGACGTGGAGCCCGGCATCT

    350     .    :    .    :    .    :    .    :    .    :
    330 TACTACATGGGCTGAAGCCCTGGACTCAGTACGCCGTTTACGTCAAGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263605 TACTACATGGGCTGAAGCCCTGGACTCAGTACGCCGTTTACGTCAAGGCT

    400     .    :    .    :    .    :    .    :    .    :
    380 GTGACCCTCACCATGGTGGAGAACGACCATATCCGTGGGGCCAAGAGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263655 GTGACCCTCACCATGGTGGAGAACGACCATATCCGTGGGGCCAAGAGTGA

    450     .    :    .    :    .    :    .    :    .    :
    430 GATCTTGTACATTCGCACCAATGCTTCAG         TTCCTTCCATTC
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 263705 GATCTTGTACATTCGCACCAATGCTTCAGGTA...CAGTTCCTTCCATTC

    500     .    :    .    :    .    :    .    :    .    :
    471 CCTTGGACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGTGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266427 CCTTGGACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGTGAAG

    550     .    :    .    :    .    :    .    :
    521 TGGAACCCTCTCTCTCTGGCCAAAGGCGAACTGAGTTACTAC
        |||||||||| ||||||| |||| ||| | ||||||||||||
 266477 TGGAACCCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTAC

END