Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF847028.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF847028.1, 245 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|12234178|gb|BF847028.1|BF847028 CM3-EN0047-281000-423-b02 EN0047 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

(complement)

1-150  (45091-45239)   98% <-
151-245  (46842-46936)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATAACGGCGTACTGAGTCCAGGCCTTCAGCCCATGTAGTAAGATGCCGGG
        |-|||||||||||||||||||| |||||||||||||||||||||||||||
  45091 A AACGGCGTACTGAGTCCAGGGCTTCAGCCCATGTAGTAAGATGCCGGG

     50     .    :    .    :    .    :    .    :    .    :
     51 CTCCACGTCCTTGTTGGGCGGGAGGTCCACGTCCACCATGTTCCAGCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45140 CTCCACGTCCTTGTTGGGCGGGAGGTCCACGTCCACCATGTTCCAGCTGT

    100     .    :    .    :    .    :    .    :    .    :
    101 TGGAGCCGCAGGCATCCTGCCCATCATACTCTGTGACATTCTTAAAGGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45190 TGGAGCCGCAGGCATCCTGCCCATCATACTCTGTGACATTCTTAAAGGGT

    150     .    :    .    :    .    :    .    :    .    :
    151          GCTTCCTTGTAGTAAACGGTGAAGCTGATGAGATCCCTGTA
        <<<...<<<|||||||||||||||||||||||||||||||||||||||||
  45240 CTG...CACGCTTCCTTGTAGTAAACGGTGAAGCTGATGAGATCCCTGTA

    200     .    :    .    :    .    :    .    :    .    :
    192 GTCAGGGGGCCGGTACCGGTGCCAGGTTATGATGATGCGATTCTTCGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  46883 GTCAGGGGGCCGGTACCGGTGCCAGGTTATGATGATGCGATTCTTCGACG

    250 
    242 TGGT
        ||||
  46933 TGGT

END