Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF929370.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF929370.1, 169 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|12327498|gb|BF929370.1|BF929370 IL2-NT0198-081200-280-B06 NT0198 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

(complement)

1-73  (36063-36135)   97% <-
74-169  (41407-41502)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CGTGGTGTTCCTGCTTCGGCTGGACATGGTGGTGTTGTTCACTTGCATGA
        |||||||||||||||||||||||||||||||||||||  |||||||||||
  36063 CGTGGTGTTCCTGCTTCGGCTGGACATGGTGGTGTTGGCCACTTGCATGA

     50     .    :    .    :    .    :    .    :    .    :
     51 CATCTCTCCGCTTCCTTTCAGGT         CTGGGCACGAAGATGGAG
        |||||||||||||||||||||||<<<...<<<||||||||||||||||||
  36113 CATCTCTCCGCTTCCTTTCAGGTCTG...TACCTGGGCACGAAGATGGAG

    100     .    :    .    :    .    :    .    :    .    :
     92 TTGTGCAGGAAATTCTCAAAGACTTTGCGGTATTCAGCCTCCTCCTTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41425 TTGTGCAGGAAATTCTCAAAGACTTTGCGGTATTCAGCCTCCTCCTTCTC

    150     .    :    .    :    .
    142 GGCCTGCTTCTCGGCTTCAGTTTTGGGG
        ||||||||||||||||||||||||||||
  41475 GGCCTGCTTCTCGGCTTCAGTTTTGGGG

END