Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF932932.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF932932.1, 393 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|12350256|gb|BF932932.1|BF932932 CM1-NT0271-201200-665-e01 NT0271 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

1-64  (266517-266582)   96% ->
65-269  (267123-267327)   99% ->
270-393  (272599-272722)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 A ATTGTGCGCTGGCAGCGGCAGC TCAGGACGGCTACCTTTACCGGCAC
        |-||||||||||||||||||||||-|||||||||||||||||||||||||
 266517 ACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCAC

     50     .    :    .    :    .    :    .    :    .    :
     49 AATTACTGCTCCAAAG         ACAAAATCCCCATCAGGAAGTATGC
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
 266567 AATTACTGCTCCAAAGGTA...AAGACAAAATCCCCATCAGGAAGTATGC

    100     .    :    .    :    .    :    .    :    .    :
     90 CGACGGCACCATTGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGG
        |||||||||||| |||||||||||||||||||||||||||||||||||||
 267148 CGACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGG

    150     .    :    .    :    .    :    .    :    .    :
    140 TGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267198 TGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCC

    200     .    :    .    :    .    :    .    :    .    :
    190 GAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267248 GAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAA

    250     .    :    .    :    .    :    .    :    .    :
    240 TTTCCTGCACAACTCCATCTTCGTGCCCAG         ACCTGAAAGGA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
 267298 TTTCCTGCACAACTCCATCTTCGTGCCCAGGTA...CAGACCTGAAAGGA

    300     .    :    .    :    .    :    .    :    .    :
    281 AGCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272610 AGCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGC

    350     .    :    .    :    .    :    .    :    .    :
    331 AGGAACACCACGGCCGCAGACACCTACAACATCACCGACCCGGAAGAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272660 AGGAACACCACGGCCGCAGACACCTACAACATCACCGACCCGGAAGAGCT

    400     .    :
    381 GGAGACAGAGTAC
        |||||||||||||
 272710 GGAGACAGAGTAC

END