Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BG700527.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BG700527.1, 775 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|13969957|gb|BG700527.1|BG700527 602680558F1 NIH_MGC_95 Homo sapiens cDNA clone IMAGE:4813022 5', mRNA sequence
>ENSG00000101017

1-114  (15-128)   97% ->
115-193  (3554-3632)   100% ->
194-319  (3967-4092)   100% ->
320-466  (4344-4490)   99% ->
467-561  (4860-4953)   97% ->
562-623  (8374-8435)   95% ->
624-718  (9872-9962)   91% ->
719-743  (10069-10093)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGCGGAGTCTGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTG
        || |||||| ||||||||||||||||||||||||||||||||||||||||
     15 AGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTG

     50     .    :    .    :    .    :    .    :    .    :
     51 GTCTCACCTCGCCATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCT
        |||||||||||| |||||||||||||||||||||||||||||||||||||
     65 GTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCT

    100     .    :    .    :    .    :    .    :    .    :
    101 GCTTGCTGACCGCT         GTCCATCCAGAACCACCCACTGCATGC
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
    115 GCTTGCTGACCGCTGTG...TAGGTCCATCCAGAACCACCCACTGCATGC

    150     .    :    .    :    .    :    .    :    .    :
    142 AGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3581 AGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCC

    200     .    :    .    :    .    :    .    :    .    :
    192 AG         GACAGAAACTGGTGAGTGACTGCACAGAGTTCACTGAAA
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
   3631 AGGTG...CAGGACAGAAACTGGTGAGTGACTGCACAGAGTTCACTGAAA

    250     .    :    .    :    .    :    .    :    .    :
    233 CGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAACAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4006 CGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAACAGA

    300     .    :    .    :    .    :    .    :    .    :
    283 GAGACACACTGCCACCAGCACAAATACTGCGACCCCA         ACCT
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
   4056 GAGACACACTGCCACCAGCACAAATACTGCGACCCCAGTG...CAGACCT

    350     .    :    .    :    .    :    .    :    .    :
    324 AGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACACCATCTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4348 AGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACACCATCTGCA

    400     .    :    .    :    .    :    .    :    .    :
    374 CCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGAGAGCTGTGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4398 CCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGAGAGCTGTGTC

    450     .    :    .    :    .    :    .    :    .    :
    424 CTGCACCGATCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTG       
        |||||||| ||||||||||||||||||||||||||||||||||>>>...>
   4448 CTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTGGTA...C

    500     .    :    .    :    .    :    .    :    .    :
    467   CTACAGGGGTTTCTGATACCATCTGCGAGCCCTGCCCAGTCGGCTTCT
        >>||||||||||||||||||||||||||||||||||||||||||||||||
   4858 AGCTACAGGGGTTTCTGATACCATCTGCGAGCCCTGCCCAGTCGGCTTCT

    550     .    :    .    :    .    :    .    :    .    :
    515 TCTCCAATGTGTCATCTGCTTTCGAAAAACTGTCACCCTTGGACGAG   
        |||||||||||||||||||||||||||||-|||||||||||||| ||>>>
   4908 TCTCCAATGTGTCATCTGCTTTCGAAAAA TGTCACCCTTGGACAAGGTA

    600     .    :    .    :    .    :    .    :    .    :
    562       CTGTGAGACCAAAGACCTGGTTGTGCA CAGGCAGGCAACAAAC
        ...>>>|||||||||||||||||||||||||||-||||||||||-|||||
   4957 ...TAGCTGTGAGACCAAAGACCTGGTTGTGCAACAGGCAGGCA CAAAC

    650     .    :    .    :    .    :    .    :    .    :
    605 AAGACTGATGTAGTCTGTG         GTCCCCAGGATCGGCTGAGAGC
        ||||||||||| |||||||>>>...>>>||||||||||||||||||||||
   8417 AAGACTGATGTTGTCTGTGGTG...CAGGTCCCCAGGATCGGCTGAGAGC

    700     .    :    .    :    .    :    .    :    .    :
    646 CCTGGTGGTGATCCCCATCATCTTCGGGAATCCTGTTTGACAATCCTCTT
        |||||||||||||||||||||||||||||-||||||||| ||-|||||||
   9894 CCTGGTGGTGATCCCCATCATCTTCGGGA TCCTGTTTGCCA TCCTCTT

    750     .    :    .    :    .    :    .    :    .    :
    696 GGTGCTGGTCTTTATCCACAAAT         GTGGGCAAGAAGCCAACC
        ||||||||||||||||-|   |->>>...>>>|||| |||||||||||||
   9942 GGTGCTGGTCTTTATC AGTGA GTC...AAGGTGGCCAAGAAGCCAACC

    800     .
    737 AATAAGG
        |||||||
  10087 AATAAGG

END