Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BG723351.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BG723351.1, 690 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|14002538|gb|BG723351.1|BG723351 602694006F1 NIH_MGC_97 Homo sapiens cDNA clone IMAGE:4826257 5', mRNA sequence
>ENSG00000140443

6-179  (266409-266582)   99% ->
180-385  (267123-267327)   99% ->
386-669  (272599-272882)   98% ->
670-690  (274327-274347)   100%

      0     .    :    .    :    .    :    .    :    .    :
      6 CTTCAGTTCCTTCCATTCCCTTGGACGTTCTTTCAGCATCGAACTCCTCT
        || |||||||||||||||||||||||||||||||||||||||||||||||
 266409 CTCCAGTTCCTTCCATTCCCTTGGACGTTCTTTCAGCATCGAACTCCTCT

     50     .    :    .    :    .    :    .    :    .    :
     56 TCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAACGGCAACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266459 TCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAACGGCAACCT

    100     .    :    .    :    .    :    .    :    .    :
    106 GAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266509 GAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTT

    150     .    :    .    :    .    :    .    :    .    :
    156 ACCGGCACAATTACTGCTCCAAAG         ACAAAATCCCCATCAGG
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
 266559 ACCGGCACAATTACTGCTCCAAAGGTA...AAGACAAAATCCCCATCAGG

    200     .    :    .    :    .    :    .    :    .    :
    197 AAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267140 AAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCAA

    250     .    :    .    :    .    :    .    :    .    :
    247 GACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267190 GACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAA

    300     .    :    .    :    .    :    .    :    .    :
    297 CTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267240 CTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTC

    350     .    :    .    :    .    :    .    :    .    :
    347 TTTGAGACATTTCCTGCACAACTCCATCTTCGTGCCCAG         AC
        |||||||-|||||||||||||||||||||||||||||||>>>...>>>||
 267290 TTTGAGA ATTTCCTGCACAACTCCATCTTCGTGCCCAGGTA...CAGAC

    400     .    :    .    :    .    :    .    :    .    :
    388 CTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACACCAC ATGTCC
        |||||||||||||||||||||||||||||||||||||||||||-||||||
 272601 CTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCC

    450     .    :    .    :    .    :    .    :    .    :
    437 AGCCGAAGCAGGAACACCACGGCCGCAGACACCTACAACATCACCGACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272651 AGCCGAAGCAGGAACACCACGGCCGCAGACACCTACAACATCACCGACCC

    500     .    :    .    :    .    :    .    :    .    :
    487 GGAAGAGCTGGAGACAGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272701 GGAAGAGCTGGAGACAGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACA

    550     .    :    .    :    .    :    .    :    .    :
    537 AGGAGAGAACTGTCATTTCTAACCTTCGGCCTTTCACATTGTACCGCATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272751 AGGAGAGAACTGTCATTTCTAACCTTCGGCCTTTCACATTGTACCGCATC

    600     .    :    .    :    .    :    .    :    .    :
    587 GATATCCACAGCTGCAAACACGAGGCTGAGAAGCTGGGCTGCAGCGCCTC
        ||||||||||||||||| ||||||||||||||||||||||||||||||||
 272801 GATATCCACAGCTGCAACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTC

    650     .    :    .    :    .    :    .    :    .    :
    637 CAAATTCGTCTTTGCAAGGACCTATGCCCGCAG         AAGGAGCA
        ||| |||||||||||||||||-|||||||||||>>>...>>>||||||||
 272851 CAACTTCGTCTTTGCAAGGAC TATGCCCGCAGGTA...CAGAAGGAGCA

    700     .    :
    678 GATGACATTCCTG
        |||||||||||||
 274335 GATGACATTCCTG

END