Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BG770185.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BG770185.1, 516 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|14080838|gb|BG770185.1|BG770185 602744944F1 NIH_MGC_49 Homo sapiens cDNA clone IMAGE:4877987 5', mRNA sequence
>ENSG00000140443

1-72  (247284-247356)   98% ->
73-217  (249928-250072)   100% ->
218-432  (259136-259350)   100% ->
433-516  (261766-261849)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GT ACTTCTGCTCAGATGCTCCAAGGATGCACCATCTTCAAGGGCAATTT
        ||-|||||||||||||||||||||||||||||||||||||||||||||||
 247284 GTTACTTCTGCTCAGATGCTCCAAGGATGCACCATCTTCAAGGGCAATTT

     50     .    :    .    :    .    :    .    :    .    :
     50 GCTCATTAACATCCGACGGGGGA         ATAACATTGCTTCAGAGC
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 247334 GCTCATTAACATCCGACGGGGGAGTA...TAGATAACATTGCTTCAGAGC

    100     .    :    .    :    .    :    .    :    .    :
     91 TGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 249946 TGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATC

    150     .    :    .    :    .    :    .    :    .    :
    141 CGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 249996 CGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCT

    200     .    :    .    :    .    :    .    :    .    :
    191 CATCCTAGGAGAGGAGCAGCTAGAAGG         GAATTACTCCTTCT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 250046 CATCCTAGGAGAGGAGCAGCTAGAAGGGTA...TAGGAATTACTCCTTCT

    250     .    :    .    :    .    :    .    :    .    :
    232 ACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259150 ACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGC

    300     .    :    .    :    .    :    .    :    .    :
    282 AACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259200 AACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATT

    350     .    :    .    :    .    :    .    :    .    :
    332 ATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259250 ATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGC

    400     .    :    .    :    .    :    .    :    .    :
    382 GCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259300 GCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCC

    450     .    :    .    :    .    :    .    :    .    :
    432 T         GTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTC
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
 259350 TGTG...CAGGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTC

    500     .    :    .    :    .    :    .    :
    473 GAAGAATCGCATCATCATAACCTGGCACCGGTACCGGCCCCCTG
        ||||||||||||||||||||||||||||||||||||||||||||
 261806 GAAGAATCGCATCATCATAACCTGGCACCGGTACCGGCCCCCTG

END