Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BG977229.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BG977229.1, 329 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|14379964|gb|BG977229.1|BG977229 CM3-CS0005-050201-706-b03 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-329  (187451-187777)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 TAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGAATCAGCTTATTGTCTA
         ||||||||||||||||||||||||||||||||-||||||||||||||||
 187451 AAAGGCAGCTCTAAATGTCAATCAGCCTAGTTG ATCAGCTTATTGTCTA

     50     .    :    .    :    .    :    .    :    .    :
     51 GTGAAACTNCGTTAATTTGTAGTGTTGTAGAAGAACTGAAATCATACTTC
        ||||||||-|||||||||||||||||| ||||||||||||||||||||||
 187500 GTGAAACT CGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTC

    100     .    :    .    :    .    :    .    :    .    :
    101 TTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187549 TTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATA

    150     .    :    .    :    .    :    .    :    .    :
    151 AGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187599 AGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAAC

    200     .    :    .    :    .    :    .    :    .    :
    201 TATATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187649 TATATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAG

    250     .    :    .    :    .    :    .    :    .    :
    251 AATACCACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187699 AATACCACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACA

    300     .    :    .    :    .
    301 TCTAGTGAGCAGTCAGGAAAGAGAACTTC
        |||||||||||||||||||||||||||||
 187749 TCTAGTGAGCAGTCAGGAAAGAGAACTTC

END