Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BG977249.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BG977249.1, 449 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|14379984|gb|BG977249.1|BG977249 CM3-CS0005-050201-706-d09 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-449  (270-720)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGACCTATCCCAGTTTT ACATAATATTTCATAGAAATACTAGTGCCATA
        |  ||| ||||||||||-||||||||||||||||||||||||||||||||
    270 TCCCCTGTCCCAGTTTTAACATAATATTTCATAGAAATACTAGTGCCATA

     50     .    :    .    :    .    :    .    :    .    :
     50 AAAAGTCAATATTTCAAATATAAAAATTATTTTATACAAATGT ATTCAT
        |||||||||||||||||||||||||||||||||||||||||||-||||||
    320 AAAAGTCAATATTTCAAATATAAAAATTATTTTATACAAATGTAATTCAT

    100     .    :    .    :    .    :    .    :    .    :
     99 AATCATTCTTTTAAGATACAGCATTGTTATATATGTTTGAAACATTATTA
        |||||||||||||| |||||||||||||||||||||||||||||||||||
    370 AATCATTCTTTTAAAATACAGCATTGTTATATATGTTTGAAACATTATTA

    150     .    :    .    :    .    :    .    :    .    :
    149 AAATAAATATTTCCTAGAGAAAAAATTTTGCTTCACAAAATTATAAAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    420 AAATAAATATTTCCTAGAGAAAAAATTTTGCTTCACAAAATTATAAAACA

    200     .    :    .    :    .    :    .    :    .    :
    199 GAAGCATATAAAACTAATTCATGATTGGTGCTTCTTCAGTGTGTCTCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    470 GAAGCATATAAAACTAATTCATGATTGGTGCTTCTTCAGTGTGTCTCTCA

    250     .    :    .    :    .    :    .    :    .    :
    249 TTCTCTCTTAGTGTAGACAGCATGAAGTACATACATCTAGCCTGAAAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    520 TTCTCTCTTAGTGTAGACAGCATGAAGTACATACATCTAGCCTGAAAACA

    300     .    :    .    :    .    :    .    :    .    :
    299 TACCACCATCAACCTATACATCTAAATGCTTGGACTTCATGTGTGTCTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    570 TACCACCATCAACCTATACATCTAAATGCTTGGACTTCATGTGTGTCTAC

    350     .    :    .    :    .    :    .    :    .    :
    349 CCACAGTGCCCATGGCCTATCTACTTACACACCCTCTACCTGGAGCTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    620 CCACAGTGCCCATGGCCTATCTACTTACACACCCTCTACCTGGAGCTTCT

    400     .    :    .    :    .    :    .    :    .    :
    399 GTGGAAAGAAGGGCTGTCCTGTGACAATTTGCACTAACATACTTTTCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    670 GTGGAAAGAAGGGCTGTCCTGTGACAATTTGCACTAACATACTTTTCCAG

    450 
    449 C
        |
    720 C

END