Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BG978979.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BG978979.1, 259 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|14381714|gb|BG978979.1|BG978979 PM1-CN0098-050101-007-b09 CN0098 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-259  (187451-187712)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 AATAGC G TCTAAATGTCA TCAGCCTAGTTGATCAGCTTATTGTCTAG
        ||  ||-|-|||||||||||-|||||||||||||||||||||||||||||
 187451 AAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAG

     50     .    :    .    :    .    :    .    :    .    :
     48 TGAAACTCGTTACTTTGTAGTGTTGGCGAAGAACTGAAATCATACTTCTT
        |||||||||||| ||||||||||||| |||||||||||||||||||||||
 187501 TGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTT

    100     .    :    .    :    .    :    .    :    .    :
     98 AGGGTTATGATTGAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAG
        |||||||||||| |||||||||||||||||||||||||||||||||||||
 187551 AGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAG

    150     .    :    .    :    .    :    .    :    .    :
    148 CTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187601 CTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTA

    200     .    :    .    :    .    :    .    :    .    :
    198 TATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187651 TATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAA

    250     .    :
    248 TACCACAGGAAC
        ||||||||||||
 187701 TACCACAGGAAC

END