Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BG980021.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BG980021.1, 295 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|14382756|gb|BG980021.1|BG980021 CM3-CN0092-180101-644-a01 CN0092 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

1-33  (78275-78309)   88% <-
34-127  (80829-80923)   97% <-
128-295  (109007-109174)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GT ATAAATAC AATCAGCATCTTAGTATACTGCT         CGTGCT
         |-||||||||-|||||||||||| ||||||||||<<<...<<<| ||||
  78275 CTAATAAATACAAATCAGCATCTTTGTATACTGCTCTA...CACCTTGCT

     50     .    :    .    :    .    :    .    :    .    :
     40 AAAGAAATTCT GCTCGTTGACCTCCACTCAGTGTGATTCCACCTTCTCC
        |||||||||||-||||||||||||||||||||||||||||||||||||||
  80835 AAAGAAATTCTTGCTCGTTGACCTCCACTCAGTGTGATTCCACCTTCTCC

    100     .    :    .    :    .    :    .    :    .    :
     89 AAGAACTATATTGTCTTTCTCTGCAAACTTGGAGATGTC         CT
        |||||||||||||||||||||||||||||||||||||||<<<...<<<||
  80885 AAGAACTATATTGTCTTTCTCTGCAAACTTGGAGATGTCCTA...TACCT

    150     .    :    .    :    .    :    .    :    .    :
    130 CTTCTAGTTGGCATGCTTTGATGACGCTTCTGTATCTATATTCGTCATAG
        ||||||||||||||||||||||||||||||||||||||||||| ||||||
 109009 CTTCTAGTTGGCATGCTTTGATGACGCTTCTGTATCTATATTCATCATAG

    200     .    :    .    :    .    :    .    :    .    :
    180 GAAACACCAAAGATGATATTTTCTTTAATGGTGCCAGGCATAATCCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 109059 GAAACACCAAAGATGATATTTTCTTTAATGGTGCCAGGCATAATCCAGGA

    250     .    :    .    :    .    :    .    :    .    :
    230 AAACTGAGAACAGAATGAAATTCTTCCACTGTGCTTAATTTTACCCTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 109109 AAACTGAGAACAGAATGAAATTCTTCCACTGTGCTTAATTTTACCCTCTG

    300     .    :    .
    280 AAGGCTCCAGTTCTCC
        ||||||||||||||||
 109159 AAGGCTCCAGTTCTCC

END