Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BG994123.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BG994123.1, 490 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|14398193|gb|BG994123.1|BG994123 PM0-HT0911-120201-015-d04 HT0911 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

(complement)

27-94  (41540-41611)   90% <-
95-261  (42152-42319)   99% <-
262-490  (45001-45229)   98%

      0     .    :    .    :    .    :    .    :    .    :
     27 CAATCT GGGG TCTCTGTGTACTCCTCAATGTCGATGGTGC GTCGGCA
        || |||-||||-||||||||  ||||||||||||||||||||-|||||||
  41540 CAGTCTTGGGGTTCTCTGTGACCTCCTCAATGTCGATGGTGCCGTCGGCA

     50     .    :    .    :    .    :    .    :    .    :
     74 TACTTCCTGATGGGGATTT GT         CTTTGGAGCAGTAATTGTG
        |||||||||||||||||||-||<<<...<<<|||||||||||||||||||
  41590 TACTTCCTGATGGGGATTTTGTCTT...TACCTTTGGAGCAGTAATTGTG

    100     .    :    .    :    .    :    .    :    .    :
    114 CCGGTAAAGGTAGCCGTCCTGAGGCTGCCGCTGCCAGCGCACAATGTAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42171 CCGGTAAAGGTAGCCGTCCTGAGGCTGCCGCTGCCAGCGCACAATGTAGT

    150     .    :    .    :    .    :    .    :    .    :
    164 AACTCAGGTTGCCGTTGGGCAGAGAGGGAGGGT CCACTTCACGATTAAC
        |||||||||||||||||||||||||||||||||-||||||||||||||||
  42221 AACTCAGGTTGCCGTTGGGCAGAGAGGGAGGGTTCCACTTCACGATTAAC

    200     .    :    .    :    .    :    .    :    .    :
    213 TGAGAAGAGGAGTTCGATGCTGAAAGAACGTCCAAGGGAATGGAAGGAA 
        |||||||||||||||||||||||||||||||||||||||||||||||||<
  42271 TGAGAAGAGGAGTTCGATGCTGAAAGAACGTCCAAGGGAATGGAAGGAAC

    250     .    :    .    :    .    :    .    :    .    :
    262         CTGTAGCATTGGTGCGAATGTACAAGATCTCACTCTTGGCCC
        <<...<<<||| ||||||||||||||||||||||||||||||||||||||
  42321 TG...TACCTGAAGCATTGGTGCGAATGTACAAGATCTCACTCTTGGCCC

    300     .    :    .    :    .    :    .    :    .    :
    304 CACGGATATGGTCGTTCTCCACCATGGTGAGGGTCACAGCCTTGACGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45043 CACGGATATGGTCGTTCTCCACCATGGTGAGGGTCACAGCCTTGACGTAA

    350     .    :    .    :    .    :    .    :    .    :
    354 ACGGCGTACTGAGTCCAGGGCTTCAGCCCATGTAGTAAGATGCCGGGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45093 ACGGCGTACTGAGTCCAGGGCTTCAGCCCATGTAGTAAGATGCCGGGCTC

    400     .    :    .    :    .    :    .    :    .    :
    404 CACGTCCTTGTNGGGCGGGAGGTCCACGTCTACCATGTTCCAGCTGTTGG
        ||||||||||| |||||||||||||||||| |||||||||||||||||||
  45143 CACGTCCTTGTTGGGCGGGAGGTCCACGTCCACCATGTTCCAGCTGTTGG

    450     .    :    .    :    .    :    .
    454 AGCCGCAGGGATCCTGCCCATCATACTCTGTGACATT
        ||||||||| |||||||||||||||||||||||||||
  45193 AGCCGCAGGCATCCTGCCCATCATACTCTGTGACATT

END