Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BI000975.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BI000975.1, 437 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|14405049|gb|BI000975.1|BI000975 PM1-HN0074-100101-005-b12 HN0074 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

(complement)

27-437  (850-1260)   99%

      0     .    :    .    :    .    :    .    :    .    :
     27 TGCATTGTGATTATCTGAAATATCGAGATTTTGGGTAGACCTGGACAATA
        || |||||||||||||||||||| |||||||| |||||||||||||||||
    850 TGTATTGTGATTATCTGAAATATTGAGATTTTTGGTAGACCTGGACAATA

     50     .    :    .    :    .    :    .    :    .    :
     77 CTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCCTGACTGCTCACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    900 CTAACCCTGATTTCCAGGATCTGGAAGTTCTCTTTCCTGACTGCTCACTA

    100     .    :    .    :    .    :    .    :    .    :
    127 GATGTTGAATGGGGCATATTTTGATGTGCAGTCTTGTGGTTCCTGTGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    950 GATGTTGAATGGGGCATATTTTGATGTGCAGTCTTGTGGTTCCTGTGGTA

    150     .    :    .    :    .    :    .    :    .    :
    177 TTCTAATACTTGCTTGGAAATGAGATAGTTGGAATGCTTAGCAAACAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1000 TTCTAATACTTGCTTGGAAATGAGATAGTTGGAATGCTTAGCAAACAATA

    200     .    :    .    :    .    :    .    :    .    :
    227 TAGTTGTGTTTCTAAACATCATGGGGAGAGGAGAGAAAAAGGAATACAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1050 TAGTTGTGTTTCTAAACATCATGGGGAGAGGAGAGAAAAAGGAATACAAG

    250     .    :    .    :    .    :    .    :    .    :
    277 CTTATATAAACCGCTGAAGTTTCCAGTTATCATTACTTAATCATAACCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1100 CTTATATAAACCGCTGAAGTTTCCAGTTATCATTACTTAATCATAACCCT

    300     .    :    .    :    .    :    .    :    .    :
    327 AAGAAGTATGATTTCAGTTCTTCTCCAACACTACAAATTAACGAGTTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1150 AAGAAGTATGATTTCAGTTCTTCTCCAACACTACAAATTAACGAGTTTCA

    350     .    :    .    :    .    :    .    :    .    :
    377 CTAGACAATAAGCTGATCAACTAGGCTGATTGACATTTAGAGCTGCCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1200 CTAGACAATAAGCTGATCAACTAGGCTGATTGACATTTAGAGCTGCCTTT

    400     .    :
    427 CCAATTACTAG
        |||||||||||
   1250 CCAATTACTAG

END