Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BI054765.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BI054765.1, 582 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|14462295|gb|BI054765.1|BI054765 MR3-GN0349-020201-003-d03 GN0349 Homo sapiens cDNA, mRNA sequence
>ENSG00000140443

(complement)

1-147  (41464-41611)   99% <-
148-315  (42152-42319)   100% <-
316-554  (45001-45239)   99% <-
555-582  (46842-46869)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TCCTCCTTCTCGGCCTGCTTCTCGGCTTCAGTTTTGGGGCAGGCGCAG A
        ||||||||||||||||||||||||||||||||||||||||||||||||-|
  41464 TCCTCCTTCTCGGCCTGCTTCTCGGCTTCAGTTTTGGGGCAGGCGCAGCA

     50     .    :    .    :    .    :    .    :    .    :
     50 AGGCCCTTTCTCCCCACCACACACCTCAGTCTTGGGGTTCTCTGTGACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41514 AGGCCCTTTCTCCCCACCACACACCTCAGTCTTGGGGTTCTCTGTGACCT

    100     .    :    .    :    .    :    .    :    .    :
    100 CCTCAATGTCGATGGTGCCGTCGGCATACTTCCTGATGGGGATTTTGT  
        ||||||||||||||||||||||||||||||||||||||||||||||||<<
  41564 CCTCAATGTCGATGGTGCCGTCGGCATACTTCCTGATGGGGATTTTGTCT

    150     .    :    .    :    .    :    .    :    .    :
    148        CTTTGGAGCAGTAATTGTGCCGGTAAAGGTAGCCGTCCTGAGG
        <...<<<|||||||||||||||||||||||||||||||||||||||||||
  41614 T...TACCTTTGGAGCAGTAATTGTGCCGGTAAAGGTAGCCGTCCTGAGG

    200     .    :    .    :    .    :    .    :    .    :
    191 CTGCCGCTGCCAGCGCACAATGTAGTAACTCAGGTTGCCGTTGGGCAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42195 CTGCCGCTGCCAGCGCACAATGTAGTAACTCAGGTTGCCGTTGGGCAGAG

    250     .    :    .    :    .    :    .    :    .    :
    241 AGGGAGGGTTCCACTTCACGATTAACTGAGAAGAGGAGTTCGATGCTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42245 AGGGAGGGTTCCACTTCACGATTAACTGAGAAGAGGAGTTCGATGCTGAA

    300     .    :    .    :    .    :    .    :    .    :
    291 AGAACGTCCAAGGGAATGGAAGGAA         CTGAAGCATTGGTGCG
        |||||||||||||||||||||||||<<<...<<<||||||||||||||||
  42295 AGAACGTCCAAGGGAATGGAAGGAACTG...TACCTGAAGCATTGGTGCG

    350     .    :    .    :    .    :    .    :    .    :
    332 AATGTACAAGATCTCACTCTTGGCCCCACGGATATGGTCGTTCTCCACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45017 AATGTACAAGATCTCACTCTTGGCCCCACGGATATGGTCGTTCTCCACCA

    400     .    :    .    :    .    :    .    :    .    :
    382 TGGTGAGGGTCACAGCCTTGACGTAAACGGCGTACTGAGTCCAGGGCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45067 TGGTGAGGGTCACAGCCTTGACGTAAACGGCGTACTGAGTCCAGGGCTTC

    450     .    :    .    :    .    :    .    :    .    :
    432 AGCCCATGTAGTAAGATGCCGGGCTCCACGTCCTTGTTGGGCGGGAGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45117 AGCCCATGTAGTAAGATGCCGGGCTCCACGTCCTTGTTGGGCGGGAGGTC

    500     .    :    .    :    .    :    .    :    .    :
    482 CACGTCCACCATGTTCCAGCTGTTGGAGCCGCAGGGATCCTGCCCATCAT
        ||||||||||||||||||||||||||||||||||| ||||||||||||||
  45167 CACGTCCACCATGTTCCAGCTGTTGGAGCCGCAGGCATCCTGCCCATCAT

    550     .    :    .    :    .    :    .    :    .    :
    532 ACTCTGTGACATTCTTAAAGGGT         GCTTCCTTGTAGTAAACG
        |||||||||||||||||||||||<<<...<<<||||||||||||||||||
  45217 ACTCTGTGACATTCTTAAAGGGTCTG...CACGCTTCCTTGTAGTAAACG

    600     .    :
    573 GTGAAGCTGA
        ||||||||||
  46860 GTGAAGCTGA

END