Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BI833481.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BI833481.1, 785 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|15945031|gb|BI833481.1|BI833481 603088145F1 NIH_MGC_120 Homo sapiens cDNA clone IMAGE:5227115 5', mRNA sequence
>ENSG00000101017

1-116  (12-128)   98% ->
117-195  (3554-3632)   100% ->
196-321  (3967-4092)   99% ->
322-468  (4344-4490)   100% ->
469-715  (9713-9958)   99% ->
716-743  (10064-10092)   86% ->
744-785  (10616-10657)   86%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCA GGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCTGCCGC
        ||||-|||||||||||||||||||||||||||||||||||||||||||||
     12 GGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCTGCCGC

     50     .    :    .    :    .    :    .    :    .    :
     50 CTGGTCTCACCTCGCCATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGG
        ||||||||||||||| ||||||||||||||||||||||||||||||||||
     62 CTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGG

    100     .    :    .    :    .    :    .    :    .    :
    100 GCTGCTTGCTGACCGCT         GTCCATCCAGAACCACCCACTGCA
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
    112 GCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAACCACCCACTGCA

    150     .    :    .    :    .    :    .    :    .    :
    141 TGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3578 TGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCA

    200     .    :    .    :    .    :    .    :    .    :
    191 GCCAG         GACAGAAACTGGTGAGTGACTGCACAGAGTTCACTG
        |||||>>>...>>>||||||||||||||||||||||||||||||||||||
   3628 GCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCACAGAGTTCACTG

    250     .    :    .    :    .    :    .    :    .    :
    232 AAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4003 AAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAAC

    300     .    :    .    :    .    :    .    :    .    :
    282 AGAGAGACACACTTCCACCAGCACAAATACTGCGACCCCA         A
        ||||||||||||| ||||||||||||||||||||||||||>>>...>>>|
   4053 AGAGAGACACACTGCCACCAGCACAAATACTGCGACCCCAGTG...CAGA

    350     .    :    .    :    .    :    .    :    .    :
    323 CCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACACCATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4345 CCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACACCATCT

    400     .    :    .    :    .    :    .    :    .    :
    373 GCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGAGAGCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4395 GCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGAGAGCTGT

    450     .    :    .    :    .    :    .    :    .    :
    423 GTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTG    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
   4445 GTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTGGTA.

    500     .    :    .    :    .    :    .    :    .    :
    469      ACATCTGCCAGCCACATTTCCCCAAGGACCGCGGTTTGAACCTTC
        ..>>>|||||||||||||||||||||||||||||||||||||||||||||
   4495 ..AAGACATCTGCCAGCCACATTTCCCCAAGGACCGCGGTTTGAACCTTC

    550     .    :    .    :    .    :    .    :    .    :
    514 TGATGTAGATGAGCTCTGACATTGGAAGATTCTGGAGTCTGACAAGTCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9758 TGATGTAGATGAGCTCTGACATTGGAAGATTCTGGAGTCTGACAAGTCAC

    600     .    :    .    :    .    :    .    :    .    :
    564 AGCAGGTTGAGGGTACGGGAGAAACTGCAGGTGAGGGGTGCATGCTGAAG
        |||||||||||||||-||||||||||||||||||||||||||||||||||
   9808 AGCAGGTTGAGGGTA GGGAGAAACTGCAGGTGAGGGGTGCATGCTGAAG

    650     .    :    .    :    .    :    .    :    .    :
    614 TCCTGATTTCTCCAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9857 TCCTGATTTCTCCAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATC

    700     .    :    .    :    .    :    .    :    .    :
    664 CCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9907 CCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTAT

    750     .    :    .    :    .    :    .    :    .    :
    714 CA         ACCAGGTGGCCAAAAAGC AACCAATAAG          
        ||>>>...>>>|  |||||||||| ||||-||||||||||>>>...>>>-
   9957 CAGTG...TAGAAAAGGTGGCCAAGAAGCCAACCAATAAGGTA...CAGG

    800     .    :    .    :    .    :    .    :
    744 CCCCCCAACCC AGACAGGAACCCCACGAAGATCAATTTTCCC
        ||||||| |||-||-||||||||||| ||-|||||||||||||
  10617 CCCCCCACCCCAAG CAGGAACCCCAGGA GATCAATTTTCCC

END