Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BI910333.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BI910333.1, 658 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|16173719|gb|BI910333.1|BI910333 603068386F1 NIH_MGC_118 Homo sapiens cDNA clone IMAGE:5217548 5', mRNA sequence
>ENSG00000101017

1-122  (7-128)   98% ->
123-201  (3554-3632)   100% ->
202-326  (3967-4092)   99% ->
327-471  (4344-4490)   98% ->
472-568  (4860-4953)   94% ->
569-638  (8374-8440)   94%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCTGGGGCAGGAGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCT
        ||||||||||| ||||||||||||||||||||||||||||||||||||||
      7 GCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCT

     50     .    :    .    :    .    :    .    :    .    :
     51 GCCGCCTGGTCTCACCTCGCCATGGTTCGTCTGCCTCTGCAGTGCGTCCT
        |||||||||||||||||||| |||||||||||||||||||||||||||||
     57 GCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTCCT

    100     .    :    .    :    .    :    .    :    .    :
    101 CTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAACCACCCA
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
    107 CTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAACCACCCA

    150     .    :    .    :    .    :    .    :    .    :
    142 CTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3573 CTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTG

    200     .    :    .    :    .    :    .    :    .    :
    192 TGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCACAGAGTT
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
   3623 TGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCACAGAGTT

    250     .    :    .    :    .    :    .    :    .    :
    233 CACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3998 CACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCT

    300     .    :    .    :    .    :    .    :    .    :
    283 GGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCC A     
        |||||||||||||||||||||||||||||||||||||||||||-|>>>..
   4048 GGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCCAGTG..

    350     .    :    .    :    .    :    .    :    .    :
    327     ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACAC
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
   4098 .CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACAC

    400     .    :    .    :    .    :    .    :    .    :
    373 CATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4390 CATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGAGA

    450     .    :    .    :    .    :    .    :    .    :
    423 GCTGTGTCCTGCACCGCTCATGCTCGCC GGCTTTGGGGTCA GCAGATT
        ||||||||||||||||||||||||||||-|||||||||||||-|||||||
   4440 GCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATT

    500     .    :    .    :    .    :    .    :    .    :
    471 G         CTACAGGGGTTTCTGATACCATCTGCGAGGCCCTAGCCAG
        |>>>...>>>|||||||||||||||||||||||||||||-||||  ||||
   4490 GGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAG CCCTGCCCAG

    550     .    :    .    :    .    :    .    :    .    :
    512 TCGGCTTTCTTCTCCAATGTGTCATCTGCTTTCGAAACAATGTCACCCTT
        |||||-|||||||||||||||||||||||||||||||-||||||||||||
   4899 TCGGC TTCTTCTCCAATGTGTCATCTGCTTTCGAAA AATGTCACCCTT

    600     .    :    .    :    .    :    .    :    .    :
    562 GGACAAG         CTGTGAGACCAAAGACCTGGTTGTGCAACAGGCA
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
   4947 GGACAAGGTA...TAGCTGTGAGACCAAAGACCTGGTTGTGCAACAGGCA

    650     .    :    .    :    .    :    .
    603 GGCACAAAACAAGACTGATGTTGTCTGTGGTCCCAG
        ||||||||-|||||||||||||||||||||| --||
   8408 GGCACAAA CAAGACTGATGTTGTCTGTGGTG  AG

END