Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BI964093.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BI964093.1, 582 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|16338498|gb|BI964093.1|BI964093 ie64g11.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA clone IMAGE:5671869 5', mRNA sequence
>ENSG00000001626

1-582  (187426-188007)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 ACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187426 ACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAG

     50     .    :    .    :    .    :    .    :    .    :
     51 CCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187476 CCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTG

    100     .    :    .    :    .    :    .    :    .    :
    101 GAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187526 GAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAAC

    150     .    :    .    :    .    :    .    :    .    :
    151 TGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187576 TGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTC

    200     .    :    .    :    .    :    .    :    .    :
    201 CCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187626 CCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTA

    250     .    :    .    :    .    :    .    :    .    :
    251 TCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187676 TCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCAC

    300     .    :    .    :    .    :    .    :    .    :
    301 ATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187726 ATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACT

    350     .    :    .    :    .    :    .    :    .    :
    351 TCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187776 TCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCT

    400     .    :    .    :    .    :    .    :    .    :
    401 CAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGGCTGTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187826 CAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGGCTGTTA

    450     .    :    .    :    .    :    .    :    .    :
    451 TAATCTTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187876 TAATCTTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATG

    500     .    :    .    :    .    :    .    :    .    :
    501 CCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187926 CCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAG

    550     .    :    .    :    .    :
    551 TTTAGCTGGAAAAGTATGTTAGTGCAAATTGT
        ||||||||||||||||||||||||||||||||
 187976 TTTAGCTGGAAAAGTATGTTAGTGCAAATTGT

END