Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BI964203.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BI964203.1, 577 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|16338608|gb|BI964203.1|BI964203 ie66b09.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA clone IMAGE:5671649 5' similar to TR:Q99989 Q99989 TRANSMEMBRANE CHLORIDE CONDUCTOR PROTEIN ;, mRNA sequence
>ENSG00000001626

1-577  (111969-112544)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 AAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATATTGGTCACTT
        ||||||||||||||||||||||||||||||||||||||| ||||||||||
 111969 AAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTCACTT

     50     .    :    .    :    .    :    .    :    .    :
     51 CTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112019 CTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAA

    100     .    :    .    :    .    :    .    :    .    :
    101 GGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112069 GGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCC

    150     .    :    .    :    .    :    .    :    .    :
    151 AGACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112119 AGACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTG

    200     .    :    .    :    .    :    .    :    .    :
    201 CAGAAAGAAGAAATTCAATCCTAACTGAGACCTTACACCGTTTCTCATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112169 CAGAAAGAAGAAATTCAATCCTAACTGAGACCTTACACCGTTTCTCATTA

    250     .    :    .    :    .    :    .    :    .    :
    251 GAAGGAGATGCTCCTGTCTCCTGGACAGAAACAAAAAAACAATCTTTTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112219 GAAGGAGATGCTCCTGTCTCCTGGACAGAAACAAAAAAACAATCTTTTAA

    300     .    :    .    :    .    :    .    :    .    :
    301 ACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAATCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112269 ACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAATCCAA

    350     .    :    .    :    .    :    .    :    .    :
    351 TCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112319 TCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATG

    400     .    :    .    :    .    :    .    :    .    :
    401 AATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112369 AATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTT

    450     .    :    .    :    .    :    .    :    .    :
    451 AGTACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112419 AGTACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGA

    500     .    :    .    :    .    :    .    :    .    :
    501 TCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112469 TCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAAC

    550     .    :    .    :    .
    551 CTGATGACACACTCAGTTAACCAAGGC
        ||||||||||||||||||||||||||-
 112519 CTGATGACACACTCAGTTAACCAAGG 

END