Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM055437.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM055437.1, 557 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|16813328|gb|BM055437.1|BM055437 ie94h04.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA clone IMAGE:5674615 5' similar to SW:CFTR_HUMAN P13569 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR ;, mRNA sequence
>ENSG00000001626

1-152  (162480-162631)   100% ->
153-242  (172880-172969)   100% ->
243-415  (184726-184898)   100% ->
416-521  (185497-185602)   100% ->
522-557  (186946-186981)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 162480 GCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTT

     50     .    :    .    :    .    :    .    :    .    :
     51 TTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 162530 TTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTG

    100     .    :    .    :    .    :    .    :    .    :
    101 GGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 162580 GGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCAC

    150     .    :    .    :    .    :    .    :    .    :
    151 AG         AAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTG
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
 162630 AGGTG...TAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTG

    200     .    :    .    :    .    :    .    :    .    :
    192 GATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 172919 GATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGA

    250     .    :    .    :    .    :    .    :    .    :
    242 G         GTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGC
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
 172969 GGTA...CAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGC

    300     .    :    .    :    .    :    .    :    .    :
    283 TTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 184766 TTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAAG

    350     .    :    .    :    .    :    .    :    .    :
    333 CAGTTGATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAGATCTTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 184816 CAGTTGATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAGATCTTGCT

    400     .    :    .    :    .    :    .    :    .    :
    383 GCTTGATGAACCCAGTGCTCATTTGGATCCAGT         AACATACC
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 184866 GCTTGATGAACCCAGTGCTCATTTGGATCCAGTGTG...TAGAACATACC

    450     .    :    .    :    .    :    .    :    .    :
    424 AAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 185505 AAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATT

    500     .    :    .    :    .    :    .    :    .    :
    474 CTCTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTG  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
 185555 CTCTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGGT

    550     .    :    .    :    .    :    .    :
    522        GTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCC
        >...>>>||||||||||||||||||||||||||||||||||||
 185605 G...TAGGTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCC

END