Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM453397.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM453397.1, 862 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|18502437|gb|BM453397.1|BM453397 AGENCOURT_6397549 NIH_MGC_72 Homo sapiens cDNA clone IMAGE:5527759 5', mRNA sequence
>ENSG00000101017

1-97  (32-128)   98% ->
98-176  (3554-3632)   100% ->
177-302  (3967-4092)   100% ->
303-449  (4344-4490)   100% ->
450-543  (4860-4953)   100% ->
544-605  (8374-8435)   100% ->
606-691  (9872-9958)   98% ->
692-720  (10064-10092)   100% ->
721-854  (10616-10734)   88%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCCATGG
        ||||||||||||||||||||||||||||||||||||||||||||| ||||
     32 CCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCTATGG

     50     .    :    .    :    .    :    .    :    .    :
     51 TTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCT   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
     82 TTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGTG

    100     .    :    .    :    .    :    .    :    .    :
     98       GTCCATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCT
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
    132 ...TAGGTCCATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCT

    150     .    :    .    :    .    :    .    :    .    :
    142 AATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAG         GACAGA
        |||||||||||||||||||||||||||||||||||>>>...>>>||||||
   3598 AATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAGGTG...CAGGACAGA

    200     .    :    .    :    .    :    .    :    .    :
    183 AACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3973 AACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGC

    250     .    :    .    :    .    :    .    :    .    :
    233 GGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4023 GGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCA

    300     .    :    .    :    .    :    .    :    .    :
    283 GCACAAATACTGCGACCCCA         ACCTAGGGCTTCGGGTCCAGC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
   4073 GCACAAATACTGCGACCCCAGTG...CAGACCTAGGGCTTCGGGTCCAGC

    350     .    :    .    :    .    :    .    :    .    :
    324 AGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4365 AGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGG

    400     .    :    .    :    .    :    .    :    .    :
    374 CACTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4415 CACTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTC

    450     .    :    .    :    .    :    .    :    .    :
    424 GCCCGGCTTTGGGGTCAAGCAGATTG         CTACAGGGGTTTCTG
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
   4465 GCCCGGCTTTGGGGTCAAGCAGATTGGTA...CAGCTACAGGGGTTTCTG

    500     .    :    .    :    .    :    .    :    .    :
    465 ATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4875 ATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCT

    550     .    :    .    :    .    :    .    :    .    :
    515 GCTTTCGAAAAATGTCACCCTTGGACAAG         CTGTGAGACCAA
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
   4925 GCTTTCGAAAAATGTCACCCTTGGACAAGGTA...TAGCTGTGAGACCAA

    600     .    :    .    :    .    :    .    :    .    :
    556 AGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   8386 AGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTG

    650     .    :    .    :    .    :    .    :    .    :
    606          GTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATC
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
   8436 GTG...CAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATC

    700     .    :    .    :    .    :    .    :    .    :
    647 ATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTATC     
        |||||||||||||||||||||||||||||||||||||||||||||->>>.
   9913 ATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTATCAGTG.

    750     .    :    .    :    .    :    .    :    .    :
    692      AAAAGGTGGCCAAGAAGCCAACCAATAAG         GCCCCCC
        ..>>>|||||||||||||||||||||||||||||>>>...>>>|||||||
   9963 ..TAGAAAAGGTGGCCAAGAAGCCAACCAATAAGGTA...CAGGCCCCCC

    800     .    :    .    :    .    :    .    :    .    :
    728 ACCCCAAGCAGGAACCCCCAGGAGATCAATNTTTTCCCGACGATCTTCCT
        ||||||||||||||||||-|||||||||||-|||-|||||||||||||||
  10623 ACCCCAAGCAGGAACCCC AGGAGATCAAT TTT CCCGACGATCTTCCT

    850     .    :    .    :    .    :    .    :    .    :
    778 GGGCTCCAACACTGGCTGCTCCAGNTGCAAGGAGACTTTTACATGGGATG
        ||-|||||||||||-|||||||||-|||-||||||||||-||||||-|||
  10670 GG CTCCAACACTG CTGCTCCAG TGC AGGAGACTTT ACATGG ATG

    900     .    :    .    :    .
    828 CCCAACCCCGGTCACCCCAAGNAAGGA
        -||||-||-||||||||-| |-|-|||
  10714  CCAA CC GGTCACCC AGG A GGA

END