Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM503804.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM503804.1, 408 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|18665961|gb|BM503804.1|BM503804 ig96a07.y1 HR85 islet Homo sapiens cDNA 5', mRNA sequence
>ENSG00000012048

(complement)

1-408  (80055-80463)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTGGAAGCACAGAGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80055 CTGGAAGCACAGAGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAG

     50     .    :    .    :    .    :    .    :    .    :
     51 TTTACTTCTCTAAAACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80105 TTTACTTCTCTAAAACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTC

    100     .    :    .    :    .    :    .    :    .    :
    101 AATGGAAGGAGAGTGCTTGGGATCGATTATGTGACTTAAAGTCAGAATAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80155 AATGGAAGGAGAGTGCTTGGGATCGATTATGTGACTTAAAGTCAGAATAG

    150     .    :    .    :    .    :    .    :    .    :
    151 TCCTTGGGCAGTTCTCAAATGTTGGAGTGGAACATTGGGGA TTTTTTTT
        |||||||||||||||||||||||||||||||||||||||||-    || |
  80205 TCCTTGGGCAGTTCTCAAATGTTGGAGTGGAACATTGGGGAGGAAATTCT

    200     .    :    .    :    .    :    .    :    .    :
    200 TAGGCAGGNATTAGAAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGC
         ||||||| |||||||||||||||||||||||||||||||||||||||||
  80255 GAGGCAGGTATTAGAAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGC

    250     .    :    .    :    .    :    .    :    .    :
    250 TCACGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80305 TCACGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACTG

    300     .    :    .    :    .    :    .    :    .    :
    300 GAGGTCAGGAGTTCGAAACCAGCCTGGCCAACATGGTGAAACCCCATCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80355 GAGGTCAGGAGTTCGAAACCAGCCTGGCCAACATGGTGAAACCCCATCTC

    350     .    :    .    :    .    :    .    :    .    :
    350 TACTAAAAATACAGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80405 TACTAAAAATACAGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCC

    400     .
    400 CAGCTACTC
        |||||||||
  80455 CAGCTACTC

END