Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM548526.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM548526.1, 1122 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|18783153|gb|BM548526.1|BM548526 AGENCOURT_6573502 NIH_MGC_124 Homo sapiens cDNA clone IMAGE:5732033 5', mRNA sequence
>ENSG00000101017

7-132  (2-128)   96% ->
133-211  (3554-3632)   100% ->
212-337  (3967-4092)   100% ->
338-484  (4344-4490)   100% ->
485-546  (8374-8435)   100% ->
547-633  (9872-9958)   100% ->
634-662  (10064-10092)   100% ->
663-811  (10616-10764)   96%

      0     .    :    .    :    .    :    .    :    .    :
      7 CCCGGGAT GGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTG
        ||  || |-|||||||||||||||||||||||||||||||||||||||||
      2 CCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTG

     50     .    :    .    :    .    :    .    :    .    :
     56 GTCCTGCCGCCTGGTCTCACCTCGCCATGGTTCGTCTGCCTCTGCAGTGC
        ||||||||||||||||||||||||| ||||||||||||||||||||||||
     52 GTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTGC

    100     .    :    .    :    .    :    .    :    .    :
    106 GTCCTCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAACC
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
    102 GTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAACC

    150     .    :    .    :    .    :    .    :    .    :
    147 ACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3568 ACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTT

    200     .    :    .    :    .    :    .    :    .    :
    197 CTTTGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCACA
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
   3618 CTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCACA

    250     .    :    .    :    .    :    .    :    .    :
    238 GAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3993 GAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGA

    300     .    :    .    :    .    :    .    :    .    :
    288 CACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4043 CACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCCA

    350     .    :    .    :    .    :    .    :    .    :
    338          ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACA
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
   4093 GTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACA

    400     .    :    .    :    .    :    .    :    .    :
    379 GACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4385 GACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTG

    450     .    :    .    :    .    :    .    :    .    :
    429 TGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4435 TGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGC

    500     .    :    .    :    .    :    .    :    .    :
    479 AGATTG         CTGTGAGACCAAAGACCTGGTTGTGCAACAGGCAG
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
   4485 AGATTGGTA...TAGCTGTGAGACCAAAGACCTGGTTGTGCAACAGGCAG

    550     .    :    .    :    .    :    .    :    .    :
    520 GCACAAACAAGACTGATGTTGTCTGTG         GTCCCCAGGATCGG
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
   8409 GCACAAACAAGACTGATGTTGTCTGTGGTG...CAGGTCCCCAGGATCGG

    600     .    :    .    :    .    :    .    :    .    :
    561 CTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTGCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9886 CTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTGCCAT

    650     .    :    .    :    .    :    .    :    .    :
    611 CCTCTTGGTGCTGGTCTTTATCA         AAAAGGTGGCCAAGAAGC
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
   9936 CCTCTTGGTGCTGGTCTTTATCAGTG...TAGAAAAGGTGGCCAAGAAGC

    700     .    :    .    :    .    :    .    :    .    :
    652 CAACCAATAAG         GCCCCCCACCCCAAGCAGGAACCCCAGGAG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  10082 CAACCAATAAGGTA...CAGGCCCCCCACCCCAAGCAGGAACCCCAGGAG

    750     .    :    .    :    .    :    .    :    .    :
    693 ATCCATTTTCCCGACGATCTTCCTGGCTCCAACACTGCTGCTCCAGGGCA
        ||| |||||||||||||||||||||||||||||||||||||||||| |||
  10646 ATCAATTTTCCCGACGATCTTCCTGGCTCCAACACTGCTGCTCCAGTGCA

    800     .    :    .    :    .    :    .    :    .    :
    743 GGAGACTTTACATGGATGCCAACCGGTCACCCAGGAGGATGGCAAAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10696 GGAGACTTTACATGGATGCCAACCGGTCACCCAGGAGGATGGCAAAGAGA

    850     .    :    .    :
    793 GTCG ATTCTCAGGGCAGGA
        ||||-|-|||||| ||||||
  10746 GTCGCA TCTCAGTGCAGGA

END