Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM761221.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM761221.1, 644 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|19090836|gb|BM761221.1|BM761221 K-EST0041983 S12SNU216 Homo sapiens cDNA clone S12SNU216-15-G08 5', mRNA sequence
>ENSG00000101017

1-128  (1-128)   99% ->
129-207  (3554-3632)   100% ->
208-333  (3967-4092)   100% ->
334-480  (4344-4490)   100% ->
481-574  (4860-4953)   100% ->
575-644  (8374-8443)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 GCCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGT

     50     .    :    .    :    .    :    .    :    .    :
     51 GGTCCTGCCGCCTGGTCTCACCTCGCCATGGTTCGTCTGCCTCTGCAGTG
        |||||||||||||||||||||||||| |||||||||||||||||||||||
     51 GGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTG

    100     .    :    .    :    .    :    .    :    .    :
    101 CGTCCTCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAAC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
    101 CGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAAC

    150     .    :    .    :    .    :    .    :    .    :
    142 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3567 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT

    200     .    :    .    :    .    :    .    :    .    :
    192 TCTTTGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCAC
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
   3617 TCTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCAC

    250     .    :    .    :    .    :    .    :    .    :
    233 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3992 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG

    300     .    :    .    :    .    :    .    :    .    :
    283 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4042 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC

    350     .    :    .    :    .    :    .    :    .    :
    333 A         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
   4092 AGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC

    400     .    :    .    :    .    :    .    :    .    :
    374 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4384 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT

    450     .    :    .    :    .    :    .    :    .    :
    424 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4434 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG

    500     .    :    .    :    .    :    .    :    .    :
    474 CAGATTG         CTACAGGGGTTTCTGATACCATCTGCGAGCCCTG
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
   4484 CAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAGCCCTG

    550     .    :    .    :    .    :    .    :    .    :
    515 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4894 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC

    600     .    :    .    :    .    :    .    :    .    :
    565 CTTGGACAAG         CTGTGAGACCAAAGACCTGGTTGTGCAACAG
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
   4944 CTTGGACAAGGTA...TAGCTGTGAGACCAAAGACCTGGTTGTGCAACAG

    650     .    :    .    :    .    :    .
    606 GCAGGCACAAACAAGACTGATGTTGTCTGTGGTGAGTCC
        |||||||||||||||||||||||||||||||||||||||
   8405 GCAGGCACAAACAAGACTGATGTTGTCTGTGGTGAGTCC

END