Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM849045.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM849045.1, 474 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|19205444|gb|BM849045.1|BM849045 K-EST0129042 S18N669761 Homo sapiens cDNA clone S18N669761-25-G04 5', mRNA sequence
>ENSG00000101017

1-81  (48-128)   98% ->
82-160  (3554-3632)   100% ->
161-286  (3967-4092)   100% ->
287-433  (4344-4490)   99% ->
434-474  (4860-4900)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGTGGTCCTGCCGCCTGGTCTCACCTCGCCATGGTTCGTCTGCCTCTGCA
        ||||||||||||||||||||||||||||| ||||||||||||||||||||
     48 AGTGGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCA

     50     .    :    .    :    .    :    .    :    .    :
     51 GTGCGTCCTCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAG
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
     98 GTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAG

    100     .    :    .    :    .    :    .    :    .    :
     92 AACCACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3564 AACCACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGC

    150     .    :    .    :    .    :    .    :    .    :
    142 TGTTCTTTGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTG
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
   3614 TGTTCTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTG

    200     .    :    .    :    .    :    .    :    .    :
    183 CACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3989 CACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCC

    250     .    :    .    :    .    :    .    :    .    :
    233 TAGACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4039 TAGACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGAC

    300     .    :    .    :    .    :    .    :    .    :
    283 CCCA         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGA
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
   4089 CCCAGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGA

    350     .    :    .    :    .    :    .    :    .    :
    324 AACAGACACCATCTGCACCTGTGAAGAAAGCTGGCACTGTACGAGTGAGG
        |||||||||||||||||||||||||||| |||||||||||||||||||||
   4381 AACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGG

    400     .    :    .    :    .    :    .    :    .    :
    374 CCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4431 CCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTC

    450     .    :    .    :    .    :    .    :    .    :
    424 AAGCAGATTG         CTACAGGGGTTTCTGATACCATCTGCGAGCC
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
   4481 AAGCAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAGCC

    500     .    :
    465 CTGCCCAGTC
        ||||||||||
   4891 CTGCCCAGTC

END