Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM905286.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM905286.1, 1032 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|19355665|gb|BM905286.1|BM905286 AGENCOURT_6698626 NIH_MGC_72 Homo sapiens cDNA clone IMAGE:5558171 5', mRNA sequence
>ENSG00000140443

8-141  (261759-261892)   97% ->
142-380  (263495-263733)   100% ->
381-548  (266415-266582)   100% ->
549-753  (267123-267327)   100% ->
754-1011  (272599-272853)   95%

      0     .    :    .    :    .    :    .    :    .    :
      8 GCCTCCTGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAA
        ||| |  |||||||||||||||||||||||||||||||||||||||||||
 261759 GCCCCAGGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAA

     50     .    :    .    :    .    :    .    :    .    :
     58 GAATCGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261809 GAATCGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGG

    100     .    :    .    :    .    :    .    :    .    :
    108 ATCTCATCAGCTTCACCGTTTACTACAAGGAAGC         ACCCTTT
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 261859 ATCTCATCAGCTTCACCGTTTACTACAAGGAAGCGTG...CAGACCCTTT

    150     .    :    .    :    .    :    .    :    .    :
    149 AAGAATGTCACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263502 AAGAATGTCACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTG

    200     .    :    .    :    .    :    .    :    .    :
    199 GAACATGGTGGACGTGGACCTCCCGCCCAACAAGGACGTGGAGCCCGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263552 GAACATGGTGGACGTGGACCTCCCGCCCAACAAGGACGTGGAGCCCGGCA

    250     .    :    .    :    .    :    .    :    .    :
    249 TCTTACTACATGGGCTGAAGCCCTGGACTCAGTACGCCGTTTACGTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263602 TCTTACTACATGGGCTGAAGCCCTGGACTCAGTACGCCGTTTACGTCAAG

    300     .    :    .    :    .    :    .    :    .    :
    299 GCTGTGACCCTCACCATGGTGGAGAACGACCATATCCGTGGGGCCAAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263652 GCTGTGACCCTCACCATGGTGGAGAACGACCATATCCGTGGGGCCAAGAG

    350     .    :    .    :    .    :    .    :    .    :
    349 TGAGATCTTGTACATTCGCACCAATGCTTCAG         TTCCTTCCA
        ||||||||||||||||||||||||||||||||>>>...>>>|||||||||
 263702 TGAGATCTTGTACATTCGCACCAATGCTTCAGGTA...CAGTTCCTTCCA

    400     .    :    .    :    .    :    .    :    .    :
    390 TTCCCTTGGACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266424 TTCCCTTGGACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGTG

    450     .    :    .    :    .    :    .    :    .    :
    440 AAGTGGAACCCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTACATTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266474 AAGTGGAACCCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTACATTGT

    500     .    :    .    :    .    :    .    :    .    :
    490 GCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266524 GCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTACT

    550     .    :    .    :    .    :    .    :    .    :
    540 GCTCCAAAG         ACAAAATCCCCATCAGGAAGTATGCCGACGGC
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 266574 GCTCCAAAGGTA...AAGACAAAATCCCCATCAGGAAGTATGCCGACGGC

    600     .    :    .    :    .    :    .    :    .    :
    581 ACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267155 ACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTGG

    650     .    :    .    :    .    :    .    :    .    :
    631 TGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267205 TGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAGC

    700     .    :    .    :    .    :    .    :    .    :
    681 AGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267255 AGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCTG

    750     .    :    .    :    .    :    .    :    .    :
    731 CACAACTCCATCTTCGTGCCCAG         ACCTGAAAGGGAGCGGAG
        |||||||||||||||||||||||>>>...>>>|||||||||| |||||||
 267305 CACAACTCCATCTTCGTGCCCAGGTA...CAGACCTGAAAGGAAGCGGAG

    800     .    :    .    :    .    :    .    :    .    :
    772 AGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGCAGGAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272617 AGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGCAGGAACA

    850     .    :    .    :    .    :    .    :    .    :
    822 CCACGGCCGCAGACACCTACAACATCACCGACCCCGGAAGAGCTGGAGAC
        ||||||||||||||||||||||||||||||||||-|||||||||||||||
 272667 CCACGGCCGCAGACACCTACAACATCACCGACCC GGAAGAGCTGGAGAC

    900     .    :    .    :    .    :    .    :    .    :
    872 AGAGTACCCTTTCTTTGAGAGCAGAAGTGGATAACCAAGGAGAGAACTGT
        |||||||||||||||||||||||||-|||||||||-||||||||||||||
 272716 AGAGTACCCTTTCTTTGAGAGCAGA GTGGATAAC AAGGAGAGAACTGT

    950     .    :    .    :    .    :    .    :    .    :
    922 CATTTCTAACCCTTCGGCCTT CACATTGTACCGCATCGATATCCACAGC
        |||||||||-|||||||||||-||||||||||||||||||||||||||||
 272764 CATTTCTAA CCTTCGGCCTTTCACATTGTACCGCATCGATATCCACAGC

   1000     .    :    .    :    .    :    .    :
    971 TGCCAACACGAGGCTTGA AACCTGGGCTGCACCCCCTCCAA
        ||| | ||||||||-|||-|| |||||||||| | |||||||
 272813 TGCAACCACGAGGC TGAGAAGCTGGGCTGCAGCGCCTCCAA

END