Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM925886.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type:


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM925886.1, 1127 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|19376265|gb|BM925886.1|BM925886 AGENCOURT_6650088 NIH_MGC_114 Homo sapiens cDNA clone IMAGE:5764172 5', mRNA sequence
>ENSG00000101017

16-93  (51-128)   96% ->
94-172  (3554-3632)   100% ->
173-298  (3967-4092)   100% ->
299-445  (4344-4490)   100% ->
446-539  (4860-4953)   100% ->
540-601  (8374-8435)   100% ->
602-688  (9872-9958)   100% ->
689-717  (10064-10092)   93% ->
718-930  (10616-10817)   89% ==
1012-1044  (10890-10920)   85%

      0     .    :    .    :    .    :    .    :    .    :
     16 GGATCTGCCGCCTGGTCTCACCTCGCCATGGTTCGTCTGCCTCTGCAGTG
        ||  |||||||||||||||||||||| |||||||||||||||||||||||
     51 GGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTG

     50     .    :    .    :    .    :    .    :    .    :
     66 CGTCCTCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAAC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
    101 CGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAAC

    100     .    :    .    :    .    :    .    :    .    :
    107 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3567 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT

    150     .    :    .    :    .    :    .    :    .    :
    157 TCTTTGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCAC
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
   3617 TCTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCAC

    200     .    :    .    :    .    :    .    :    .    :
    198 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3992 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG

    250     .    :    .    :    .    :    .    :    .    :
    248 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4042 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC

    300     .    :    .    :    .    :    .    :    .    :
    298 A         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
   4092 AGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC

    350     .    :    .    :    .    :    .    :    .    :
    339 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4384 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT

    400     .    :    .    :    .    :    .    :    .    :
    389 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4434 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG

    450     .    :    .    :    .    :    .    :    .    :
    439 CAGATTG         CTACAGGGGTTTCTGATACCATCTGCGAGCCCTG
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
   4484 CAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAGCCCTG

    500     .    :    .    :    .    :    .    :    .    :
    480 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4894 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC

    550     .    :    .    :    .    :    .    :    .    :
    530 CTTGGACAAG         CTGTGAGACCAAAGACCTGGTTGTGCAACAG
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
   4944 CTTGGACAAGGTA...TAGCTGTGAGACCAAAGACCTGGTTGTGCAACAG

    600     .    :    .    :    .    :    .    :    .    :
    571 GCAGGCACAAACAAGACTGATGTTGTCTGTG         GTCCCCAGGA
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
   8405 GCAGGCACAAACAAGACTGATGTTGTCTGTGGTG...CAGGTCCCCAGGA

    650     .    :    .    :    .    :    .    :    .    :
    612 TCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9882 TCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTG

    700     .    :    .    :    .    :    .    :    .    :
    662 CCATCCTCTTGGTGCTGGTCTTTATCA         AAAAGGGGGCCAAG
        |||||||||||||||||||||||||||>>>...>>>|||||| |||||||
   9932 CCATCCTCTTGGTGCTGGTCTTTATCAGTG...TAGAAAAGGTGGCCAAG

    750     .    :    .    :    .    :    .    :    .    :
    703 AAACCAACCAATAAG         GCCCCCCACCCCAAGCAGGAACCCTC
        || ||||||||||||>>>...>>>||||||||||||||||||||||||-|
  10078 AAGCCAACCAATAAGGTA...CAGGCCCCCCACCCCAAGCAGGAACCC C

    800     .    :    .    :    .    :    .    :    .    :
    744 AGGAGATCCATTTTTCCCGACGATCTTCCGTGGCTCCAACACTGCCTGCT
        |||||||| |-||||||||||||||||||-|||||||||||||||-||||
  10641 AGGAGATCAA TTTTCCCGACGATCTTCC TGGCTCCAACACTGC TGCT

    850     .    :    .    :    .    :    .    :    .    :
    794 CCAGGGCAGGAAACTTTACCTGGGATGCCAACCGGTCACCCAGGAAGGAT
        |||| |||||| ||||||| |-|||||||||||||||||||||||-||||
  10688 CCAGTGCAGGAGACTTTACAT GGATGCCAACCGGTCACCCAGGA GGAT

    900     .    :    .    :    .    :    .    :    .    :
    844 GGGCAAAGAGAGTCCCATCTCAGTGCAAGAAAAAACAGTGAGGCTGGCCC
        ||-||||||||||| |||||||||||| || | -||||||||||||  ||
  10736 GG CAAAGAGAGTCGCATCTCAGTGCAGGAGAG ACAGTGAGGCTGCACC

    950     .    :    .    :    .    :    .
    894 CACCCCAGGA TGGTGGCCCACGTGGGCCAAACAGGCA
        |||||-||||-|-||||-||||||||||-|||||||||
  10784 CACCC AGGAGT GTGG CCACGTGGGC AAACAGGCA

      0     .    :    .    :    .    :
   1012 CCCCGCTTTTGCCTGCACCCCCTG AGGTTTTGA
        |||||||| ||||||||||||-||-|-||||-||
  10890 CCCCGCTTCTGCCTGCACCCC TGCA GTTT GA

END