Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM972363.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM972363.1, 634 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|19589954|gb|BM972363.1|BM972363 UI-CF-EC1-abq-g-16-0-UI.s1 UI-CF-EC1 Homo sapiens cDNA clone UI-CF-EC1-abq-g-16-0-UI 3', mRNA sequence
>ENSG00000001626

(complement)

20-634  (1-617)   99%

      0     .    :    .    :    .    :    .    :    .    :
     20 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA

     50     .    :    .    :    .    :    .    :    .    :
     70 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA

    100     .    :    .    :    .    :    .    :    .    :
    120 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA

    150     .    :    .    :    .    :    .    :    .    :
    170 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC

    200     .    :    .    :    .    :    .    :    .    :
    220 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG

    250     .    :    .    :    .    :    .    :    .    :
    270 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA

    300     .    :    .    :    .    :    .    :    .    :
    320 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT

    350     .    :    .    :    .    :    .    :    .    :
    370 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA

    400     .    :    .    :    .    :    .    :    .    :
    420 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    401 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC

    450     .    :    .    :    .    :    .    :    .    :
    470 TTCACAAAATTATAAAACAGAA AATATAAAACTAATTCATGATTGGTGC
        ||||||||||||||||||||||- ||||||||||||||||||||||||||
    451 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC

    500     .    :    .    :    .    :    .    :    .    :
    519 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    501 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA

    550     .    :    .    :    .    :    .    :    .    :
    569 TACATCTAGCCTGAAAACAT CCACCATCAACCTATACATCTAAATGCTT
        ||||||||||||||||||||-|||||||||||||||||||||||||||||
    551 TACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGCTT

    600     .    :    .
    618 GGACTTCATGTGTGTCT
        |||||||||||||||||
    601 GGACTTCATGTGTGTCT

END