Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM984670.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM984670.1, 673 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|19610417|gb|BM984670.1|BM984670 UI-CF-EC1-abj-k-24-0-UI.s1 UI-CF-EC1 Homo sapiens cDNA clone UI-CF-EC1-abj-k-24-0-UI 3', mRNA sequence
>ENSG00000017427

17-235  (94-312)   100% <-
236-412  (17255-17431)   100% <-
413-573  (73385-73545)   98% <-
574-673  (78065-78165)   98%

      0     .    :    .    :    .    :    .    :    .    :
     17 TTGGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     94 TTGGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA

     50     .    :    .    :    .    :    .    :    .    :
     67 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    144 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT

    100     .    :    .    :    .    :    .    :    .    :
    117 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    194 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGG

    150     .    :    .    :    .    :    .    :    .    :
    167 AGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    244 AGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTG

    200     .    :    .    :    .    :    .    :    .    :
    217 CGTTCTTCAAATGTACTTC         CTTCTGGGTCTTGGGCATGTCG
        |||||||||||||||||||<<<...<<<||||||||||||||||||||||
    294 CGTTCTTCAAATGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCG

    250     .    :    .    :    .    :    .    :    .    :
    258 GTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17277 GTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGG

    300     .    :    .    :    .    :    .    :    .    :
    308 TGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17327 TGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACT

    350     .    :    .    :    .    :    .    :    .    :
    358 CATCCACGATGCCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17377 CATCCACGATGCCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACCCT

    400     .    :    .    :    .    :    .    :    .    :
    408 GTGGG         CTTGCTGAAATAAAA CCCCTGTCTCCACACACGAA
        |||||<<<...<<<-|| |||||||||||-||||||||||||||||||||
  17427 GTGGGCTT...TAC TTACTGAAATAAAAGCCCCTGTCTCCACACACGAA

    450     .    :    .    :    .    :    .    :    .    :
    448 CTGAAGAGCATCCACCAGCTCAGCCCCGCAGAGCGTCTCCGGTCCAGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  73420 CTGAAGAGCATCCACCAGCTCAGCCCCGCAGAGCGTCTCCGGTCCAGCCG

    500     .    :    .    :    .    :    .    :    .    :
    498 TGGCAGAGCTGGTGAAGGTGAGCAGGCACAGCGCCAGGTAGAAGAGATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  73470 TGGCAGAGCTGGTGAAGGTGAGCAGGCACAGCGCCAGGTAGAAGAGATGC

    550     .    :    .    :    .    :    .    :    .    :
    548 GAGGAGGACATGGTGTGCATCTTCAC         CTTCAAGAAATCACA
        ||||||||||||||||||||||||||<<<...<<<|||||||||||||||
  73520 GAGGAGGACATGGTGTGCATCTTCACCTG...TACCTTCAAGAAATCACA

    600     .    :    .    :    .    :    .    :    .    :
    589 AAAGCAGCACTTAAATAATTGGGTTGGAAGACTGCTGATTTTTCGCATTG
        |||||||||||||||||||||||||||||||||||||||||||| |||||
  78080 AAAGCAGCACTTAAATAATTGGGTTGGAAGACTGCTGATTTTTCCCATTG

    650     .    :    .    :    .    :    .
    639 CTTCTGAAGTACAA GTCTGAAAATGAATTGGTTAG
        ||||||||||||||-|||||||||||||||||||||
  78130 CTTCTGAAGTACAAAGTCTGAAAATGAATTGGTTAG

END