Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM987679.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM987679.1, 302 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|19707068|gb|BM987679.1|BM987679 UI-H-CO0-ass-f-10-0-UI.s1 NCI_CGAP_Sub9 Homo sapiens cDNA clone IMAGE:5859978 3', mRNA sequence
>ENSG00000140443

19-302  (1-284)   99%

      0     .    :    .    :    .    :    .    :    .    :
     19 GAGAAAGGGGAATTTTATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGA
        ||||||||||||||| ||||||||||||||||||||||||||||||||||
      1 GAGAAAGGGGAATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGA

     50     .    :    .    :    .    :    .    :    .    :
     69 GGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCT

    100     .    :    .    :    .    :    .    :    .    :
    119 CTCGCTCTGGCCGACGAGTGGAGAAAGTGAGTATGTGCCCGCCGCCCGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CTCGCTCTGGCCGACGAGTGGAGAAAGTGAGTATGTGCCCGCCGCCCGCG

    150     .    :    .    :    .    :    .    :    .    :
    169 GCCACTGCGGGAACTTTTCCTCCGAGGGGCTGCGCCCTGTTTGCGAAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 GCCACTGCGGGAACTTTTCCTCCGAGGGGCTGCGCCCTGTTTGCGAAACC

    200     .    :    .    :    .    :    .    :    .    :
    219 CGAGTTGCCACCGTCGCAGCTGTCGGGCCCCCGGGCTCGGGAGCGGGGGG
        |||||||||||||||||||||||||||||||||||||||||||||| |||
    201 CGAGTTGCCACCGTCGCAGCTGTCGGGCCCCCGGGCTCGGGAGCGGCGGG

    250     .    :    .    :    .    :
    269 GTGGGGCGCAGGGCGGCTCTGCCGGGAGGGAGGC
        ||||||||||||||||||||||||||||||||||
    251 GTGGGGCGCAGGGCGGCTCTGCCGGGAGGGAGGC

END