Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ323154.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ323154.1, 438 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|20933902|gb|BQ323154.1|BQ323154 CM3-CS0005-060401-755-e07 CS0005 Homo sapiens cDNA, mRNA sequence
>ENSG00000001626

1-438  (187323-187762)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 ACTCTATCGATAAATGGCTTCCTGGCACTAGTCAAAT GTCTG GAGG A
          |||-|-||||||||||||||||||| |||||||||-|| ||- |||-|
 187323 GGTCT T GATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTA

     50     .    :    .    :    .    :    .    :    .    :
     48  ATGAAATCCTTGAAGATTTACCACTTGTGTATTGCAAGCCAGATTTTCC
        - | ||||||||||||||||||||||||||| ||||||||||||||||||
 187371 CTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCC

    100     .    :    .    :    .    :    .    :    .    :
     97 TGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187421 TGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCA

    150     .    :    .    :    .    :    .    :    .    :
    147 ATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187471 ATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAG

    200     .    :    .    :    .    :    .    :    .    :
    197 TGTTGTAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATG
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
 187521 TGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATG

    250     .    :    .    :    .    :    .    :    .    :
    247 ATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187571 ATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTC

    300     .    :    .    :    .    :    .    :    .    :
    297 CTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTGAGCATTCC
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
 187621 CTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCC

    350     .    :    .    :    .    :    .    :    .    :
    347 AACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187671 AACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGAC

    400     .    :    .    :    .    :    .    :
    397 TGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTC
        ||||||||||||||||||||||||||||||||||||||||||
 187721 TGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTC

END