Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ651337.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ651337.1, 887 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|21775509|gb|BQ651337.1|BQ651337 AGENCOURT_8490247 NIH_MGC_100 Homo sapiens cDNA clone IMAGE:6298571 5', mRNA sequence
>ENSG00000140443

1-213  (263521-263733)   100% ->
214-381  (266415-266582)   100% ->
382-586  (267123-267327)   100% ->
587-873  (272599-272881)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAACATGGTGGACGTGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263521 ATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAACATGGTGGACGTGGAC

     50     .    :    .    :    .    :    .    :    .    :
     51 CTCCCGCCCAACAAGGACGTGGAGCCCGGCATCTTACTACATGGGCTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263571 CTCCCGCCCAACAAGGACGTGGAGCCCGGCATCTTACTACATGGGCTGAA

    100     .    :    .    :    .    :    .    :    .    :
    101 GCCCTGGACTCAGTACGCCGTTTACGTCAAGGCTGTGACCCTCACCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263621 GCCCTGGACTCAGTACGCCGTTTACGTCAAGGCTGTGACCCTCACCATGG

    150     .    :    .    :    .    :    .    :    .    :
    151 TGGAGAACGACCATATCCGTGGGGCCAAGAGTGAGATCTTGTACATTCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263671 TGGAGAACGACCATATCCGTGGGGCCAAGAGTGAGATCTTGTACATTCGC

    200     .    :    .    :    .    :    .    :    .    :
    201 ACCAATGCTTCAG         TTCCTTCCATTCCCTTGGACGTTCTTTC
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
 263721 ACCAATGCTTCAGGTA...CAGTTCCTTCCATTCCCTTGGACGTTCTTTC

    250     .    :    .    :    .    :    .    :    .    :
    242 AGCATCGAACTCCTCTTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266443 AGCATCGAACTCCTCTTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTC

    300     .    :    .    :    .    :    .    :    .    :
    292 TGCCCAACGGCAACCTGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266493 TGCCCAACGGCAACCTGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCT

    350     .    :    .    :    .    :    .    :    .    :
    342 CAGGACGGCTACCTTTACCGGCACAATTACTGCTCCAAAG         A
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
 266543 CAGGACGGCTACCTTTACCGGCACAATTACTGCTCCAAAGGTA...AAGA

    400     .    :    .    :    .    :    .    :    .    :
    383 CAAAATCCCCATCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267124 CAAAATCCCCATCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGG

    450     .    :    .    :    .    :    .    :    .    :
    433 TCACAGAGAACCCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267174 TCACAGAGAACCCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGC

    500     .    :    .    :    .    :    .    :    .    :
    483 TGCGCCTGCCCCAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267224 TGCGCCTGCCCCAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGC

    550     .    :    .    :    .    :    .    :    .    :
    533 TGAATACCGCAAAGTCTTTGAGAATTTCCTGCACAACTCCATCTTCGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267274 TGAATACCGCAAAGTCTTTGAGAATTTCCTGCACAACTCCATCTTCGTGC

    600     .    :    .    :    .    :    .    :    .    :
    583 CCAG         ACCTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCC
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
 267324 CCAGGTA...CAGACCTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCC

    650     .    :    .    :    .    :    .    :    .    :
    624 AACACCACCATGTCCAGCCGAAGCAGGAACACCACGGCCGCAGACACCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272636 AACACCACCATGTCCAGCCGAAGCAGGAACACCACGGCCGCAGACACCTA

    700     .    :    .    :    .    :    .    :    .    :
    674 CAACATCACCCGACCCGGAAGAGCTGGGAGACAGAGTACCCTTTCTTTGA
        ||||||||||-||||||||||||||||-||||||||||||||||||||||
 272686 CAACATCACC GACCCGGAAGAGCTGG AGACAGAGTACCCTTTCTTTGA

    750     .    :    .    :    .    :    .    :    .    :
    724 GAGCAGAGTGGATAANCAGGAGAGAACTGTCATTTCTAACCTTCGGCCTT
        |||||||||||||||  |||||||||||||||||||||||||||||||||
 272734 GAGCAGAGTGGATAACAAGGAGAGAACTGTCATTTCTAACCTTCGGCCTT

    800     .    :    .    :    .    :    .    :    .    :
    774 TCACATTGTACCGCATCGATATCCACAGCTGCAACCACNAGGNCTGAAAA
        |||||||||||||||||||||||||||||||||||||| |||-|||| -|
 272784 TCACATTGTACCGCATCGATATCCACAGCTGCAACCACGAGG CTGAG A

    850     .    :    .    :    .    :    .    :    .    :
    824 AGCTGGGCTGCAGCGCCTCCAACTTCGTCTTTGGCA GACTATGCCCCGC
        |||||||||||||||||||||||||||||||||  |-||||||||||-||
 272832 AGCTGGGCTGCAGCGCCTCCAACTTCGTCTTTGCAAGGACTATGCCC GC

    900 
    873 A
        |
 272881 A

END