Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ681242.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ681242.1, 959 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|21793921|gb|BQ681242.1|BQ681242 AGENCOURT_8196940 NIH_MGC_112 Homo sapiens cDNA clone IMAGE:6263634 5', mRNA sequence
>ENSG00000012048

(complement)

1-63  (77686-77749)   98% ->
64-834  (79590-80345)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 CAGG TGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGA
        ||||-|||||||||||||||||||||||||||||||||||||||||||||
  77686 CAGGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGA

     50     .    :    .    :    .    :    .    :    .    :
     50 CAATGGCTTCCATG         CAATTGGGCAGATGTGTGAGGCACCTG
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
  77736 CAATGGCTTCCATGGTA...CAGCAATTGGGCAGATGTGTGAGGCACCTG

    100     .    :    .    :    .    :    .    :    .    :
     91 TGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79617 TGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAG

    150     .    :    .    :    .    :    .    :    .    :
    141 GAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79667 GAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACT

    200     .    :    .    :    .    :    .    :    .    :
    191 GCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGAGCTTACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79717 GCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGAGCTTACAA

    250     .    :    .    :    .    :    .    :    .    :
    241 AGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79767 AGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTAC

    300     .    :    .    :    .    :    .    :    .    :
    291 TGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAGGACTTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79817 TGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAGGACTTCTG

    350     .    :    .    :    .    :    .    :    .    :
    341 GCTATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79867 GCTATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAA

    400     .    :    .    :    .    :    .    :    .    :
    391 TCTGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79917 TCTGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAA

    450     .    :    .    :    .    :    .    :    .    :
    441 AACCATTTAAACGCCACCAATTGAGCAAGATGCTGATTCATTATTTATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79967 AACCATTTAAACGCCACCAATTGAGCAAGATGCTGATTCATTATTTATCA

    500     .    :    .    :    .    :    .    :    .    :
    491 GCCCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80017 GCCCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAG

    550     .    :    .    :    .    :    .    :    .    :
    541 AGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80067 AGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTA

    600     .    :    .    :    .    :    .    :    .    :
    591 AAACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80117 AAACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGA

    650     .    :    .    :    .    :    .    :    .    :
    641 GTGCTTGNGATCGATTATGTGACTTANAGTCAGAATAGTCCTTGGGCAGT
        ||||||| |||||||||||||||||| |||||||||||||||||||||||
  80167 GTGCTTGGGATCGATTATGTGACTTAAAGTCAGAATAGTCCTTGGGCAGT

    700     .    :    .    :    .    :    .    :    .    :
    691 TCTCAAATGGTTGGAGTGGAACCTGGGGGGAGGAAAATTCTGAGGCAGGG
        |||||||||-|||||||||||| | ||||-|||-|||||||||||||||-
  80217 TCTCAAATG TTGGAGTGGAACATTGGGG AGG AAATTCTGAGGCAGG 

    750     .    :    .    :    .    :    .    :    .    :
    741 TATTAAAAAATGGAAAAGGAAACTTGAAAACCTTGGGCCATGGTGGGCTC
        ||||| |||-||-||||||||||||||||-|||-||||-|||||-|||||
  80263 TATTAGAAA TG AAAAGGAAACTTGAAA CCT GGGC ATGGT GGCTC

    800     .    :    .    :    .    :    .    :
    791 ACGCCCTGTAATCCCCCAGCACTTTGGGGAAGGCCAAGGGGGGC
        |||-||||||||-|||-|||||||||||--||||||||| ||||
  80307 ACG CCTGTAAT CCC AGCACTTTGGG  AGGCCAAGGTGGGC

END