Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ683955.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ683955.1, 933 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|21796634|gb|BQ683955.1|BQ683955 AGENCOURT_8210541 NIH_MGC_112 Homo sapiens cDNA clone IMAGE:6259097 5', mRNA sequence
>ENSG00000012048

(complement)

1-75  (57710-57784)   100% ->
76-153  (61441-61518)   100% ->
154-194  (62019-62059)   100% ->
195-278  (68257-68340)   100% ->
279-333  (74275-74329)   100% ->
334-407  (76198-76271)   100% ->
408-468  (77689-77749)   100% ->
469-890  (79590-80005)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57710 AGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAG

     50     .    :    .    :    .    :    .    :    .    :
     51 ACTACTCATGTTGTTATGAAAACAG         ATGCTGAGTTTGTGTG
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
  57760 ACTACTCATGTTGTTATGAAAACAGGTA...CAGATGCTGAGTTTGTGTG

    100     .    :    .    :    .    :    .    :    .    :
     92 TGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  61457 TGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAG

    150     .    :    .    :    .    :    .    :    .    :
    142 TTAGCTATTTCT         GGGTGACCCAGTCTATTAAAGAAAGAAAA
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
  61507 TTAGCTATTTCTGTA...TAGGGGTGACCCAGTCTATTAAAGAAAGAAAA

    200     .    :    .    :    .    :    .    :    .    :
    183 ATGCTGAATGAG         CATGATTTTGAAGTCAGAGGAGATGTGGT
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
  62048 ATGCTGAATGAGGTA...CAGCATGATTTTGAAGTCAGAGGAGATGTGGT

    250     .    :    .    :    .    :    .    :    .    :
    224 CAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68286 CAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACA

    300     .    :    .    :    .    :    .    :    .    :
    274 GAAAG         ATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCC
        |||||>>>...>>>||||||||||||||||||||||||||||||||||||
  68336 GAAAGGTA...CAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCC

    350     .    :    .    :    .    :    .    :    .    :
    315 TTCACCAACATGCCCACAG         ATCAACTGGAATGGATGGTACA
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
  74311 TTCACCAACATGCCCACAGGTA...TAGATCAACTGGAATGGATGGTACA

    400     .    :    .    :    .    :    .    :    .    :
    356 GCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76220 GCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCA

    450     .    :    .    :    .    :    .    :    .    :
    406 CA         GGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGG
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
  76270 CAGTA...CAGGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGG

    500     .    :    .    :    .    :    .    :    .    :
    447 ACAGAGGACAATGGCTTCCATG         CAATTGGGCAGATGTGTGA
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
  77728 ACAGAGGACAATGGCTTCCATGGTA...CAGCAATTGGGCAGATGTGTGA

    550     .    :    .    :    .    :    .    :    .    :
    488 GGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79609 GGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACC

    600     .    :    .    :    .    :    .    :    .    :
    538 AGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79659 AGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCAC

    650     .    :    .    :    .    :    .    :    .    :
    588 TACTGACTGCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79709 TACTGACTGCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGA

    700     .    :    .    :    .    :    .    :    .    :
    638 GCTTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79759 GCTTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGT

    750     .    :    .    :    .    :    .    :    .    :
    688 CCTTCTACTGTCCTGGCTACTAAATATTTTATGTACATCANCCTGAAAAG
        |||||||||||||||||||||||||||||||||||||||| |||||||||
  79809 CCTTCTACTGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAG

    800     .    :    .    :    .    :    .    :    .    :
    738 GACTTCTGGCTATGCAAGGGTCCCTTAAAGGATTTCTGGCTTGA GCCTC
        ||||||||||||||||||||||||||||||  ||||||-|||||-| |||
  79859 GACTTCTGGCTATGCAAGGGTCCCTTAAAGATTTTCTG CTTGAAGTCTC

    850     .    :    .    :    .    :    .    :    .    :
    787 CCTTGGAAATCTGCCATGAGCACAAAATTATGGTAAATTTTTCCCCTTGA
        ||||||||||||||||||||||||||||||||||||-|||||| |||-||
  79908 CCTTGGAAATCTGCCATGAGCACAAAATTATGGTAA TTTTTCACCT GA

    900     .    :    .    :    .    :    .    :    .    :
    837 AAAGATTTTTAAACCATTTAAAACGCCACCAATTTGAGCACAGAGGCTGG
         |||||||| ||||||||||||-|||||||||||-|||||-||| ||||-
  79956 GAAGATTTTAAAACCATTTAAA CGCCACCAATT GAGCA AGATGCTG 

    950 
    887 ATTC
        ||||
  80002 ATTC

END