Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ786970.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ786970.1, 421 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|21995442|gb|BQ786970.1|BQ786970 il52c06.x1 HR85 islet Homo sapiens cDNA clone IMAGE:6033419 3' similar to SW:IGF1_CAVPO P17647 INSULIN-LIKE GROWTH FACTOR I PRECURSOR ;, mRNA sequence
>ENSG00000017427

1-306  (7-312)   100% <-
307-421  (17255-17369)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      7 TATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGAC

     50     .    :    .    :    .    :    .    :    .    :
     51 CATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     57 CATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTAC

    100     .    :    .    :    .    :    .    :    .    :
    101 TTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    107 TTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTT

    150     .    :    .    :    .    :    .    :    .    :
    151 ATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    157 ATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAA

    200     .    :    .    :    .    :    .    :    .    :
    201 GGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    207 GGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTAC

    250     .    :    .    :    .    :    .    :    .    :
    251 ATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    257 ATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATG

    300     .    :    .    :    .    :    .    :    .    :
    301 TACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGGG
        ||||||<<<...<<<|||||||||||||||||||||||||||||||||||
    307 TACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGGG

    350     .    :    .    :    .    :    .    :    .    :
    342 CACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17290 CACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACATC

    400     .    :    .    :    .    :
    392 TCCAGCCTCCTTAGATCACAGCTCCGGAAG
        ||||||||||||||||||||||||||||||
  17340 TCCAGCCTCCTTAGATCACAGCTCCGGAAG

END