Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ787248.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ787248.1, 267 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|21995720|gb|BQ787248.1|BQ787248 il52c06.y1 HR85 islet Homo sapiens cDNA clone IMAGE:6033419 5' similar to SW:IGF1_CAVPO P17647 INSULIN-LIKE GROWTH FACTOR I PRECURSOR ;, mRNA sequence
>ENSG00000017427

(complement)

1-114  (60925-61038)   100% ->
115-267  (77981-78133)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60925 TTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAA

     50     .    :    .    :    .    :    .    :    .    :
     51 GCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCACACCGACATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60975 GCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCACACCGACATGC

    100     .    :    .    :    .    :    .    :    .    :
    101 CCAAGACCCAGAAG         GAAGTACATTTGAAGAACGCAAGTAGA
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
  61025 CCAAGACCCAGAAGGTA...TAGGAAGTACATTTGAAGAACGCAAGTAGA

    150     .    :    .    :    .    :    .    :    .    :
    142 GGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACCCTCCTGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78008 GGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACCCTCCTGAGGA

    200     .    :    .    :    .    :    .    :    .    :
    192 GTGAAGAGTGACATGCCACCGCAGGATCCTTTGCTCTGCACGAGTTACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78058 GTGAAGAGTGACATGCCACCGCAGGATCCTTTGCTCTGCACGAGTTACCT

    250     .    :    .    :    .
    242 GTTAAACTTTGGAACACCTACCAAAA
        ||||||||||||||||||||||||||
  78108 GTTAAACTTTGGAACACCTACCAAAA

END