Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BU076824.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BU076824.1, 334 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|22518013|gb|BU076824.1|BU076824 in18a03.x1 Human Fetal Pancreas 1B Homo sapiens cDNA clone IMAGE: 3' similar to SW:IGF1_CAVPO P17647 INSULIN-LIKE GROWTH FACTOR I PRECURSOR ;, mRNA sequence
>ENSG00000017427

1-219  (94-312)   99% <-
220-334  (17255-17369)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA
        || |||||||||||||||||||||||||||||||||||||||||||||||
     94 TTGGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA

     50     .    :    .    :    .    :    .    :    .    :
     51 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    144 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT

    100     .    :    .    :    .    :    .    :    .    :
    101 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    194 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGG

    150     .    :    .    :    .    :    .    :    .    :
    151 AGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    244 AGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTG

    200     .    :    .    :    .    :    .    :    .    :
    201 CGTTCTTCAAATGTACTTC         CTTCTGGGTCTTGGGCATGTCG
        |||||||||||||||||||<<<...<<<||||||||||||||||||||||
    294 CGTTCTTCAAATGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCG

    250     .    :    .    :    .    :    .    :    .    :
    242 GTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17277 GTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGG

    300     .    :    .    :    .    :    .    :
    292 TGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAG
        |||||||||||||||||||||||||||||||||||||||||||
  17327 TGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAG

END