Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BU538356.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BU538356.1, 972 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|22848797|gb|BU538356.1|BU538356 AGENCOURT_10180952 NIH_MGC_107 Homo sapiens cDNA clone IMAGE:6568897 5', mRNA sequence
>ENSG00000140443

1-229  (58232-58460)   100% ==
771-791  (113496-113516)   100% ==
923-949  (115765-115791)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 TCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTTCGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58232 TCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTTCGAG

     50     .    :    .    :    .    :    .    :    .    :
     51 ATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTACTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58282 ATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTACTCG

    100     .    :    .    :    .    :    .    :    .    :
    101 GGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCCACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58332 GGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCCACTG

    150     .    :    .    :    .    :    .    :    .    :
    151 TGGACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGTGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58382 TGGACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGTGGGG

    200     .    :    .    :    .
    201 AATAAGCCCCCAAAGGAATGTGGGGACCT
        |||||||||||||||||||||||||||||
  58432 AATAAGCCCCCAAAGGAATGTGGGGACCT

      0     .    :    .    :
    771 AAAAAAAAAAAAAAAAAAATT
        |||||||||||||||||||||
 113496 AAAAAAAAAAAAAAAAAAATT

      0     .    :    .    :    .
    923 TTTTTTTTTCTTTTTTTTTTTTTGAGA
        ||||||||| |||||||||||||||||
 115765 TTTTTTTTTTTTTTTTTTTTTTTGAGA

END