Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BU679389.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BU679389.1, 524 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|23527284|gb|BU679389.1|BU679389 UI-CF-DU1-aau-i-06-0-UI.s1 UI-CF-DU1 Homo sapiens cDNA clone UI-CF-DU1-aau-i-06-0-UI 3', mRNA sequence
>ENSG00000012048

24-520  (1-497)   99%

      0     .    :    .    :    .    :    .    :    .    :
     24 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA

     50     .    :    .    :    .    :    .    :    .    :
     74 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA

    100     .    :    .    :    .    :    .    :    .    :
    124 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT

    150     .    :    .    :    .    :    .    :    .    :
    174 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT

    200     .    :    .    :    .    :    .    :    .    :
    224 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG

    250     .    :    .    :    .    :    .    :    .    :
    274 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT

    300     .    :    .    :    .    :    .    :    .    :
    324 CATGCCAGAGGTCTTATATTTTAAGAGGAATGGATTATATACCAGAGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 CATGCCAGAGGTCTTATATTTTAAGAGGAATGGATTATATACCAGAGCTA

    350     .    :    .    :    .    :    .    :    .    :
    374 CAACAATAAACATTTTACTTATTACTAATGAGGAATTAGAAGACTGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 CAACAATAAACATTTTACTTATTACTAATGAGGAATTAGAAGACTGTCTT

    400     .    :    .    :    .    :    .    :    .    :
    424 TGGAAACCGGTTCTTGAAAATCTTCTGCTGTTTTAGAACACATTCTTTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||| 
    401 TGGAAACCGGTTCTTGAAAATCTTCTGCTGTTTTAGAACACATTCTTTAG

    450     .    :    .    :    .    :    .    :    .
    474 AAATCTAGCAAATATATCTCAGACTTTTAGAAATCTCTTCTACCCTC
        ||||||||||||||||||||||||||||||||||||||||||   ||
    451 AAATCTAGCAAATATATCTCAGACTTTTAGAAATCTCTTCTAGTTTC

END