Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BU790473.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BU790473.1, 555 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|23840928|gb|BU790473.1|BU790473 in51f08.y1 HR85 islet Homo sapiens cDNA clone IMAGE:6125726 5', mRNA sequence
>ENSG00000001626

1-555  (187316-187868)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTTTAATCCGCCGTG
        |||||||||||||||||||||||||||||||||||||  ||| -| -|||
 187316 TGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATT GT GTG

     50     .    :    .    :    .    :    .    :    .    :
     51 AAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187364 AAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAG

    100     .    :    .    :    .    :    .    :    .    :
    101 ATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187414 ATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTA

    150     .    :    .    :    .    :    .    :    .    :
    151 AATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187464 AATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAA

    200     .    :    .    :    .    :    .    :    .    :
    201 TTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATTTTTT
        |||||||||||||||||||||||||||||||||||||||||||||  || 
 187514 TTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTA

    250     .    :    .    :    .    :    .    :    .    :
    251 TTTAATGATAACTGGAAACTTCAGCGGNTTATATAAGCTTGTATTCCTTT
          ||||||||||||||||||||||||| ||||||||||||||||||||||
 187564 AGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTT

    300     .    :    .    :    .    :    .    :    .    :
    301 TTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187614 TTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAA

    350     .    :    .    :    .    :    .    :    .    :
    351 GCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187664 GCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACC

    400     .    :    .    :    .    :    .    :    .    :
    401 ACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187714 ACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCA

    450     .    :    .    :    .    :    .    :    .    :
    451 GGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187764 GGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTC

    500     .    :    .    :    .    :    .    :    .    :
    501 TACCAAAAATCTCAATATTTCAGATAATCACAATACATCCCTTACCTGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187814 TACCAAAAATCTCAATATTTCAGATAATCACAATACATCCCTTACCTGGG

    550     .
    551 AAAGG
        |||||
 187864 AAAGG

END