Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BU849760.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BU849760.1, 868 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|24034723|gb|BU849760.1|BU849760 AGENCOURT_10440908 NIH_MGC_109 Homo sapiens cDNA clone IMAGE:6598434 5', mRNA sequence
>ENSG00000140443

(complement)

1-117  (23343-23459)   100% <-
118-188  (27978-28048)   100% <-
189-291  (28623-28725)   100% <-
292-451  (33599-33758)   100% <-
452-588  (34271-34407)   100% <-
589-868  (35852-36127)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 CATCTTTCACCACACCCTTGGCAACTCCTTCATAGACCATCCCAAACGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23343 CATCTTTCACCACACCCTTGGCAACTCCTTCATAGACCATCCCAAACGAC

     50     .    :    .    :    .    :    .    :    .    :
     51 CCCTGCCCAAGTTCCCGGCTCATGGTGATCTTCTCCCGAGCCACCTCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23393 CCCTGCCCAAGTTCCCGGCTCATGGTGATCTTCTCCCGAGCCACCTCCCA

    100     .    :    .    :    .    :    .    :    .    :
    101 CTCATCAGGAACGTACA         CATCAGCAGCGCTGAAGTACTCCG
        |||||||||||||||||<<<...<<<||||||||||||||||||||||||
  23443 CTCATCAGGAACGTACACTG...TACCATCAGCAGCGCTGAAGTACTCCG

    150     .    :    .    :    .    :    .    :    .    :
    142 GGTTCACAGAGGCATACAGCACTCCATTCCCCAGCCTGCTGTTATTT   
        |||||||||||||||||||||||||||||||||||||||||||||||<<<
  28002 GGTTCACAGAGGCATACAGCACTCCATTCCCCAGCCTGCTGTTATTTCTG

    200     .    :    .    :    .    :    .    :    .    :
    189       CTCTTTCTATGGAAGACGTACAGCATAATCACCAACCCTCCCAC
        ...<<<||||||||||||||||||||||||||||||||||||||||||||
  28052 ...GACCTCTTTCTATGGAAGACGTACAGCATAATCACCAACCCTCCCAC

    250     .    :    .    :    .    :    .    :    .    :
    233 GATCAACAGGACAGCGACGGGCAGAGCGATGATCAGATGGATGAAGTTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  28667 GATCAACAGGACAGCGACGGGCAGAGCGATGATCAGATGGATGAAGTTTT

    300     .    :    .    :    .    :    .    :    .    :
    283 CATATCCTG         TTTTGGCCTGGACATAGAAGAACACAGGATCT
        |||||||||<<<...<<<||||||||||||||||||||||||||||||||
  28717 CATATCCTGCTG...TACTTTTGGCCTGGACATAGAAGAACACAGGATCT

    350     .    :    .    :    .    :    .    :    .    :
    324 GTCCACGACCCATTCCCAGAGAGAGATGTGGCCTGAATCCGGGCTGTGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33631 GTCCACGACCCATTCCCAGAGAGAGATGTGGCCTGAATCCGGGCTGTGTA

    400     .    :    .    :    .    :    .    :    .    :
    374 GTTCCCCGGGTTTAGCCGGTTTAGCTTGGCCCCTCCATACTTCCTGTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33681 GTTCCCCGGGTTTAGCCGGTTTAGCTTGGCCCCTCCATACTTCCTGTATT

    450     .    :    .    :    .    :    .    :    .    :
    424 CCTGTCTGGACACACATTCTCGCTGATC         CTCAACTTGTGAT
        ||||||||||||||||||||||||||||<<<...<<<|||||||||||||
  33731 CCTGTCTGGACACACATTCTCGCTGATCCTG...TACCTCAACTTGTGAT

    500     .    :    .    :    .    :    .    :    .    :
    465 CCGTATTTTATTTCATACATTAGAATCAATCCATTGGGATTCTCAGGTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34284 CCGTATTTTATTTCATACATTAGAATCAATCCATTGGGATTCTCAGGTTC

    550     .    :    .    :    .    :    .    :    .    :
    515 CGGCCACTTTAAAAAGATGGAGTTTTCAGGCCTTGGCTCCCAGGTCACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34334 CGGCCACTTTAAAAAGATGGAGTTTTCAGGCCTTGGCTCCCAGGTCACTG

    600     .    :    .    :    .    :    .    :    .    :
    565 GCCCAGGAATGTCATCTGCTCCTT         CTGCGGGCATAGTCCCT
        ||||||||||||||||||||||||<<<...<<<|||||||||||||||-|
  34384 GCCCAGGAATGTCATCTGCTCCTTCTG...TACCTGCGGGCATAGTCC T

    650     .    :    .    :    .    :    .    :    .    :
    606 TGCAAAGACGAAGTTGGAGGCGCTGCAGCCCAGCTTCTCAGCCTCGTGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  35868 TGCAAAGACGAAGTTGGAGGCGCTGCAGCCCAGCTTCTCAGCCTCGTGGT

    700     .    :    .    :    .    :    .    :    .    :
    656 TGCAGCTGTGGATATCGATGCGGTACAATGTGAAAGGCCCAAAGTTAGAA
        ||||||||||||||||||||||||||||||||||||||| || |||||||
  35918 TGCAGCTGTGGATATCGATGCGGTACAATGTGAAAGGCCGAAGGTTAGAA

    750     .    :    .    :    .    :    .    :    .    :
    706 ATGACAGTTCTCTCCTTGTTATCCACTCTGCTCTCAAAGAAAGGGTACTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  35968 ATGACAGTTCTCTCCTTGTTATCCACTCTGCTCTCAAAGAAAGGGTACTC

    800     .    :    .    :    .    :    .    :    .    :
    756 TGTCTCCAGCTCTTTCCGGGTCGGTGATGTTGTAGGTGTCTGCGGCCGTG
        ||||||||||||||-|||||||||||||||||||||||||||||||||||
  36018 TGTCTCCAGCTCTT CCGGGTCGGTGATGTTGTAGGTGTCTGCGGCCGTG

    850     .    :    .    :    .    :    .    :    .    :
    806 GTGTTCCTGGCTTCGGCTGGACAGGGTGGGGGTTGGCCACTTGCATGACA
        |||||||||-||||||||||||| ||||| |-||||||||||||||||||
  36067 GTGTTCCTG CTTCGGCTGGACATGGTGGTG TTGGCCACTTGCATGACA

    900     .    :
    856 TCTCTCCGCTTCC
        |||||||||||||
  36115 TCTCTCCGCTTCC

END