Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX098596.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX098596.1, 391 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|27829499|gb|BX098596.1|BX098596 BX098596 NCI_CGAP_Ov35 Homo sapiens cDNA clone IMAGp998F065597 ; IMAGE:2260997, mRNA sequence
>ENSG00000001626

(complement)

15-391  (127953-128329)   97%

      0     .    :    .    :    .    :    .    :    .    :
     15 AAAGCATAANAAGTATTTATTTGCTTCTTAATCATATACAAGTTTATCCA
        ||||||||| ||||||||||||||||||||||||||||||||||||||||
 127953 AAAGCATAATAAGTATTTATTTGCTTCTTAATCATATACAAGTTTATCCA

     50     .    :    .    :    .    :    .    :    .    :
     65 ATTAGCTTTGTATAAATTGAGTCTTATCACTTGAAAACTTTANAATTTCT
        |||||||||||||||||||||||||||||||||||||||||| |||||||
 128003 ATTAGCTTTGTATAAATTGAGTCTTATCACTTGAAAACTTTAGAATTTCT

    100     .    :    .    :    .    :    .    :    .    :
    115 CAAAGCTGCTAGCTACATCAGTATTATTGGGATTTTAAGGNAATTTGGCA
        |||||||||||||||||||||||||||||||||||||||| |||||||||
 128053 CAAAGCTGCTAGCTACATCAGTATTATTGGGATTTTAAGGTAATTTGGCA

    150     .    :    .    :    .    :    .    :    .    :
    165 TAAAANGCCACTCTCATCCATCATACTGTCCAGAGAAATGCTAGGAAAAG
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
 128103 TAAAATGCCACTCTCATCCATCATACTGTCCAGAGAAATGCTAGGAAAAG

    200     .    :    .    :    .    :    .    :    .    :
    215 TTTAAGGNGAACATTCCTAGTATTAGCTGGCAACTTTTATAACTTCCTAG
        ||||||| ||||||||||||||||||||||||||||||||||||||||||
 128153 TTTAAGGTGAACATTCCTAGTATTAGCTGGCAACTTTTATAACTTCCTAG

    250     .    :    .    :    .    :    .    :    .    :
    265 GGAAGGAAATTTCTTTTTCTATCTTTTCGCACATTTTTGCAAAGTTCATT
         |||||||||||||||||||||||||||||||||||||||||||||||||
 128203 TGAAGGAAATTTCTTTTTCTATCTTTTCGCACATTTTTGCAAAGTTCATT

    300     .    :    .    :    .    :    .    :    .    :
    315 ANAACTGATCTATTGACTGATTATTTAAATCATAGTATATAANGCAGCAT
        | |||||||||||||||||||||||||||||||||||||||| |||||||
 128253 AGAACTGATCTATTGACTGATTATTTAAATCATAGTATATAATGCAGCAT

    350     .    :    .    :    .
    365 TATGGTACATTACCTGTATTTTGTTTA
        |||||||||||||||||||||||||||
 128303 TATGGTACATTACCTGTATTTTGTTTA

END